Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 43P
Mutations in the HPRT1 gene in humans result in at least two clinical syndromes. Consult OMIM (www.omim.org) by querying HPRT1; you will only need to look briefly at the top three hits (files #300322, 300323, and 308000).
a. | What is the full name of the HPRT1 enzyme? |
b. | On which chromosome is the HPRT1 gene located? |
c. | Mutations in HPRT1 are associated with two different syndromes. What are these syndromes? For each answer the following questions: (i) what are the symptoms associated with the syndrome? (ii) is the mutant allele that causes the syndrome dominant, recessive, codominant, or incompletely dominant with respect to the normal allele, or do special conditions apply? (iii) Is the syndrome associated with a loss-of function or a gain-of-function disease allele? (iv) does the syndrome display allelic heterogeneity? (v) does the syndrome display locus heterogeneity? (Note: You do not need to understand everything in the OMIM enteries to answer these questions.) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell?
I need help fimiding this in the artticle and answer as short as possible
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/
There are dozens of common variations of the c-myc gene, which are associated with different types of cancer. Here are 3 variations of part of a sequence of the c-myc gene, located between nucleotides 180 and 201. The original sequence is given to you, as well as the sequences of 3 variations. The mutated nucleotide of each variation is annotated in gray. Use this information (picture) to answer the next two (2) questions
1. Which of the c-myc variations is least likely to cause a change in c-myc function?2. Which variation of c-myc produces a nonsense mutation?
What restriction enzyme (or enzymes) would you use to cut the following...
(Gene of Interest is Bolded)
1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…
Chapter 11 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 11 - Choose the phrase from the right column that best...Ch. 11 - Would you characterize the pattern of inheritance...Ch. 11 - Would you be more likely to find single nucleotide...Ch. 11 - A recent estimate of the rate of base...Ch. 11 - If you examine Fig. 11.5 closely, you will note...Ch. 11 - Approximately 50 million SNPs have thus far been...Ch. 11 - Mutations at simple sequence repeat SSR loci occur...Ch. 11 - Humans and gorillas last shared a common ancestor...Ch. 11 - In 2015, an international team of scientists...Ch. 11 - Using PCR, you want to amplify an approximately 1...
Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.arrow_forwardNot all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial DNA are notable exceptions. With these ideas in mind, let’s consider the cloning of a sheep (e.g., Dolly). A. With regard to maternal effect genes, is the phenotype of such a cloned animal determined by the animal that donated the enucleatedegg or by the animal that donated the somatic cell nucleus? Explain.arrow_forwardAnswer each of the following questions correctly.(2-5 sentences only)(DO NOT USE THE EXAMPLE I PROVIDED FOR YOUR ANSWER( A. How cloning and expression of certain genes allows for massive production of the desired product.(Give an specific example, AGAIN PLEASE DO NOT USE THIS EXAMPLE AS YOUR EXAMPLE FOR MY QUESTION. YOU ARE NOT ALLOWED TO COPY AND PASTE MY EXAMPLE FOR YOUR ANSWER. PLEASE PROVIDE ANOTHER EXAMPLE .DO NOT USE MY EXAMPLE) For example: the cloning and expression of insulin in bacteria allows for the mass production of this necessary protein for use by diabetic patients.arrow_forward
- From the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the “Alignments” section). QUESTION What is the “Official Symbol” and “Official Full Name” for this gene?arrow_forwardYou are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop codon) of the following gene. Please write down the sequences of primers. (Indicate the 5' and 3' of the primers). 4. 5'atgaagaccaatagagagcaggaaatttacgttgaaagaagcttcaaaccaaacaattcaacaattcagaatttgatggacattgaaag gttcattttgcctcacacttctacatcaggtgtcgcaaggctcaaaatgagggtcatatcatgggtegggcttcagttctacaactactga-3’arrow_forwardA couple with a child affected with DBA undergoes in vitro fertilization (IVF) and genetic testing of the resulting embryos to ensure that the embryos will not have DBA. However, they also want the embryos screened to ensure that the one implanted can serve as a suitable donor for their existing child. Their plan is to have stem cells from the umbilical cord of the new baby transplanted to their existing child with DBA, thereby curing the condition. What are the ethical pros and cons of this situation?arrow_forward
- As the leading scientist in a biomedical science laboratory, it is up to you to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the CO1 gene of 750bp. a. They observe no band appearing on an agarose gel. What would be your conclusion? b. They observe three bands of different sizes that resemble a smear on the gel. Advise. a. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their conclusion? Explainarrow_forwardTitled “Techniques utilized to generate a genetically engineered organism and confirm gene disruption.” a. In the table, indicate with an "x" if the reagent or technique applies to DNA, RNA, and/or protein. You can have more than one "x" in each row or none at all.arrow_forwardYou are working in the lab with two known carcinogens found in cigarette smoke: Benzo(a)pyren (BaP) and nitrosamine ketone (NNK). BaP is an aromatic hydrocarbon and the mechanism of carcinogenesis is through oxidation reactions with DNA. NNK is a nitrosoamine. Describe how these two kinds of carcinogens lead to mutations. (Be detailed. Remember you are graded on effort/completeness.)arrow_forward
- this is what i have said about this image so far, what else can be said aswell including the raw count column. " Interpreting the results of an RNA-Seq analysis is pivotal in understanding the underlying genetic mechanisms of diseases such as breast cancer. In this analysis, Figure 1 provides comprehensive data on differentially expressed genes associated with breast cancer. By delving into the provided information, we can gain valuable insights into the molecular landscape of this disease. First focus is on the gene with the highest fold change, EYA4, situated on chromosome 6. With a staggering fold change of 3604.4176, EYA4 exhibits an unprecedented level of overexpression in cancerous cells compared to normal cells. This profound alteration suggests a pivotal role for EYA4 in breast cancer pathogenesis. The log2 fold change of 11.81555 further emphasizes the magnitude of this difference in gene expression. Statistical significance is evident, with an exceptionally low p-value of…arrow_forwardLeber Congenital Amaurosis (LCA) causes progressive vision loss due to defects in the gene that encodes RPE65 isomerase. Affected individuals are homozygous recessive for mutant alleles of the RPE65 gene. You are trying to determine the molecular nature of the mutations in three individuals with LCA. For ease of analysis, you may assume that each individual is homozygous for the same mutant allele (though the three individuals have different mutations than each other). You use the polymerase chain reaction to amplify DNA from each patient and you determine the sequence of the DNA and compare it to unaffected individuals. You identify the following differences. Note that the non-template strand of DNA is given and the changes are highlighted using red boldface. You can assume that the sequences are in the first reading frame (eg. the first three nucleotides of each sequence is a codon). The coding region of the gene is 1602 bp and the position of the sequences shown below is…arrow_forwardYou have a patient in your clinic presenting symptoms of cystic fibrosis. You screen their CFTR gene for mutations, and find the following list: CFTR 320 L V CFTR 341 S W CFTR 528 E D CFTR 976 F Q CFTR 1235 S R Which mutation(s) are likely causing cystic fibrosis in this patient? You also sequence a newborn family member of this patient. They have all of these same mutations, other than the one at position 976, and no other mutations in CFTR. Do you predict this person will develop cystic fibrosis? Explain why.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY