Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 23P
A partial sequence of the wild-type HbβA allele is shown here (the top strand is the RNA-like coding strand, and the location of the disease-causing mutation is underlined):
and the sickle-cell allele HBβ sequence is:
Design two 21-
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else!
Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible
(100 words max.)
A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated.
Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA?
a.
250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb
b.
2.0kb
c.
250 bp, 400 bp, 450 bp, 500 bp and 550 bp
d.
100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
A purified recombinant protein is analyzed for molecular weight by SDS-PAGE at pH 8.5. From the protein sequence deduced from the gene that was expressed in bacteria, the protein is expected to have a molecular weight of 44,000. However, the molecular weight of the protein is found by SDS-PAGE to be 52,000. Explain the reason or reasons for this difference in molecular weight. What calculation could you make to help explain this discrepancy?
Chapter 11 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 11 - Choose the phrase from the right column that best...Ch. 11 - Would you characterize the pattern of inheritance...Ch. 11 - Would you be more likely to find single nucleotide...Ch. 11 - A recent estimate of the rate of base...Ch. 11 - If you examine Fig. 11.5 closely, you will note...Ch. 11 - Approximately 50 million SNPs have thus far been...Ch. 11 - Mutations at simple sequence repeat SSR loci occur...Ch. 11 - Humans and gorillas last shared a common ancestor...Ch. 11 - In 2015, an international team of scientists...Ch. 11 - Using PCR, you want to amplify an approximately 1...
Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possiblearrow_forwarda)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer presentarrow_forwardA lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible(100 words maximum)arrow_forward
- The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…arrow_forward1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with Sbf1, Pst1, and a mixture of Sbf1 and Pst1. From these results, you obtain these fragments following agarose gel electrophoresis of the three samples: Sbf1: 7kb and 10kb Pstl: 3kb, 6kb and 8kb Sbf1 and Pstl: 1kb, 2kb, 6kb and 8kb Question: In which of the Pstl fragments is the Sbfl site located? 8kb O 6kb 3kb O None of the abovearrow_forwardThe DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGarrow_forward
- Compared to the normal A allele, the disease-causing allele in sickle cell anemia (S allele) is missing an MstII restriction site. On a Southern blot of genomic DNA cut with MstII and hybridized with the probe shown on the diagram below, a person with sickle anemia, carrying two S alleles, will show Choose an answer below: a single band at 1.1 kb. a single band at 1.3 kb. a single band at 0.2 kb. one band at 0.2 and one at 1.3 kb. one band at 1.1 and one at 1.3 kb.arrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forwardRecombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and D gene segments which undergo recombination to generate the final V region coding exon. Some of these have 12-nucleotide spacers between the heptamer and nonamer, and others have 23-nucleotide spacers. The reason recombination signal sequences come in these two forms is: To ensure the correct assembly of gene segments so that a VH recombines to a DH and not to another VH, for instance To ensure that the heptamer and nonamer are found on the same face of the DNA double helix To ensure that alpha, lambda, and heavy chains recombine within a locus and not between loci To ensure that alpha, lambda, and heavy chain gene segments do not undergo recombination with non-immunoglobulin genes To ensure that the RAG recombinase cuts the DNA between the last nucleotide of the heptamer and the coding sequencearrow_forward
- When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were obtained: Tetranucleotide Hexanucleotide Nonanucleotide Decanucleotide Dodenucleotide Octadecanucleotide Nonadecanucleotide 21-nucleotide 6c. What is the sequence of the bases in the mRNA coding for the peptide above? Thearrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY