GENETICS(LL)-W/CONNECT >CUSTOM<
6th Edition
ISBN: 9781260571561
Author: HARTWELL
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 22P
a. | What DNA sequences are found at the telomeres of human chromosomes? |
b. | What functions do the two telomere-associated complexes, telomerase, and shelterin, fulfill at chromosome ends? |
c. | Where do you think that the RNA component of telomerase comes from? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A). Briefly describe the function of telomerase. B). How does the structure of telomerase allow it to complete the function you described?
a. Propose three different mutations to prevent initiation, elongation, and termination of bacterial
DNA replication, respectively. Explain how/why each mutation would prevent its respective step.
(Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)
b. In the early 1900s, Avery, MacLeod, and McCarty performed an experiment in bacterial cells to
determine whether DNA, RNA, or protein functions as the 'transforming molecule' (i.e. the genetic
material). In your own words, how did their experiment (depicted in the figure below) help to
answer that question?
Consider the following segment of DNA, which is part of a linear chromosome:
LEFT 5’.…TGACTGACAGTC….3’
3’.…ACTGACTGTCAG….5’ RIGHT
During RNA transcription, this double-strand DNA molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. _____________ is the template strand for the synthesis of RNA? The sequence of the newly transcribed mRNA is _________________.
Question 5 options:
The top strand, 5'...GACUGUCAGUCA...3'
The bottom strand, 5'...ACUCACUCUCAG...3'
The top strand, 5'...UGACUGACAGUC...3'
The bottom strand, 5'...GACUGUCAGUCA...3'
Chapter 12 Solutions
GENETICS(LL)-W/CONNECT >CUSTOM<
Ch. 12 - For each of the terms in the left column, choose...Ch. 12 - Many proteins other than histones are found...Ch. 12 - What difference exists between the compaction of...Ch. 12 - What is the role of the core histones in...Ch. 12 - a. About how many molecules of histone H2A would...Ch. 12 - The enzyme micrococcal nuclease can cleave...Ch. 12 - a. What letters are used to represent the short...Ch. 12 - About 2000 G bands are visible in a...Ch. 12 - Suppose you performed a fluorescence in situ...Ch. 12 - Which of the following would be suggested by a...
Ch. 12 - For each of the following pairs of chromatin...Ch. 12 - a. Drosophila b. Humans Give examples of...Ch. 12 - One histone modification that is seen consistently...Ch. 12 - Recently, scientists constructed a transgene that...Ch. 12 - Drosophila geneticists have isolated many...Ch. 12 - On the following figures, genes A and B are on the...Ch. 12 - Prob. 17PCh. 12 - The first page of this chapter displays photos of...Ch. 12 - The human genome contains about 3 billion base...Ch. 12 - The mitotic cell divisions in the early embryo of...Ch. 12 - In an experiment published in the journal Cell in...Ch. 12 - a. What DNA sequences are found at the telomeres...Ch. 12 - Prob. 23PCh. 12 - a. In a fluorescent in situ hybridization FISH...Ch. 12 - If you are comparing the two telomeres in each...Ch. 12 - a. What DNA sequences are commonly found at human...Ch. 12 - On the graphs presented in Problem 21, no data is...Ch. 12 - Prob. 29PCh. 12 - Prob. 30PCh. 12 - In the 1920s, Barbara McClintock, later a Nobel...Ch. 12 - Give at least one example of a chromosomal...Ch. 12 - Cornelia de Lange syndrome CdLS is a rare human...Ch. 12 - a. Give at least three examples of types of...Ch. 12 - A number of yeast-derived elements were added to...Ch. 12 - Prob. 36PCh. 12 - The completely synthetic yeast chromosome Syn III...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using the figure below identify: What is the role of histones and nucleosomes? How the process of chromatin condensation is performed? What is a function of introns and exons? What is a role of mobile DNA elements? What is a meaning of simple-sequence DNA?arrow_forwardConsider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?arrow_forwardCancer cells must be able to proliferate indefinitely. Therefore, many inappropriately express telomerase. a. What is the function of telomerase? b. Why does telomerase enable cells to proliferate indefinitely?arrow_forward
- 3b) Briefly explain what telomerase does, how it accomplishes what it does, and why that allows a cell to completely and accurately replicate the ends of linear DNA molecules. (please note that the question does not ask you to explain the entire process of replication of the end of a linear DNA strand, it only asks about the function of telomerase in this process)arrow_forwardHow is the DNA unwound at the replication fork? What effect does this have on the DNA upstream of the fork, and how does the cell deal with this effect? b. Sliding clamps are topologically-closed rings that can encircle the DNA double helix. How, then, are they able to get on and off the DNA? What purpose is served by this striking topology?arrow_forwardOxidative deamination of adenine produces hypoxanthine (the base of inosine), which can base pair with cytosine. (a) If no repair takes place, describe the makeup of the DNA in the two daughter cells following cell division. (b) Describe the makeup of the DNA in the four daughter cells following a second round of cell division.arrow_forward
- A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the phosphoribosyl backbone and the attachment point for nucleotides added as “A” or “G”. B. Diagram the product of digestion was a restriction enzyme to cut this sequence between the A and G.arrow_forwardAn article entitled “Nucleosome Positioning at the Replication Fork” states: “both the ‘old’ randomly segregated nucleosomes as well as the ‘new’ assembled histone octamers rapidly position themselves (within seconds) on the newly replicated DNA strands” [Lucchini et al. (2002)]. Given this statement, how would one compare the distribution of nucleosomes and DNA in newly replicated chromatin? How could one experimentally test the distribution of nucleosomes on newly replicated chromosomes?arrow_forwardUsing a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase activity. Please help me with this! Thank you!arrow_forward
- Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events. a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events. Please help explain in fewer than 8 sentences!arrow_forwardDefine telomere and describe the possible connections between telomerase and cell aging and between telomerase and cancer.arrow_forwardThe diagram depicts one strand of DNA at the end of a chromosome. This strand has been replicated and produced two fragments, as shown below. Which of the two gaps that exist, labeled (a) and (b), can be filled by DNA polymerase? Hint: remember the directionality requirement for DNA polymerase. a) gap (a) b) gap (b) c) both gaps (a) and (b) d) neither gaps (a) nor (b)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License