Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 12, Problem 8Q
Summary Introduction
To review:
Hypertriglyceridemia and side effects of consumption of high fructose foods.
Introduction:
Hypertriglyceridemia is a condition in which the levels of triglycerides increase in the blood manifolds. This condition occurs primarily due to the consumption of highamount of sucrose and fructose in place of glucose. Sucrose has been replaced by high-fructose corn syrup in many industries due to the fact that it is more sweetened than sucrose; it is now used in many foods and beverage industries. Too much sugar consumptionincreases calorie intake by a lot, which in turn can lead to diabetes, high cholesterol, and ultimately affects the heart, thus causing heart diseases.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In a dietary context, what is the difference between natural sugar and refined sugar?
Why are refined sugars said to contain empty calories?
Among the many eat-all-you-want-and-lose-weight diets that have been popular for a time is one that eliminates all carbohydrates but permits the consumption of all the protein and fat desired. Would such a diet be effective?
Why is hydrogenation so appealing that companies will continue to include hydrogenated oils in their products despite the social stigma that trans fats have acquired? If hydrogenation is supposed to produce saturated fats, then why do its byproducts include these undesirable trans unsaturated fats? Eliminating fat from the diet to decrease health risks, yet many nutrition arguments are being made about the importance and value of fats in a balanced diet. Discuss these points and how you feel fats can be incorporated into a healthy diet, if at all.
Chapter 12 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 12 - Prob. 1QCh. 12 - Prob. 2QCh. 12 - Prob. 3QCh. 12 - Prob. 4QCh. 12 - Prob. 5QCh. 12 - Prob. 6QCh. 12 - Prob. 7QCh. 12 - Prob. 8QCh. 12 - Prob. 9QCh. 12 - Prob. 10Q
Ch. 12 - Prob. 1RQCh. 12 - Prob. 2RQCh. 12 - Prob. 3RQCh. 12 - Prob. 4RQCh. 12 - Prob. 5RQCh. 12 - Prob. 6RQCh. 12 - Prob. 7RQCh. 12 - Prob. 8RQCh. 12 - Prob. 9RQCh. 12 - Prob. 10RQCh. 12 - Prob. 11RQCh. 12 - Prob. 12RQCh. 12 - Prob. 13RQCh. 12 - Prob. 14RQCh. 12 - Prob. 15RQCh. 12 - Prob. 16RQCh. 12 - Prob. 17RQCh. 12 - Prob. 18RQCh. 12 - Prob. 19RQCh. 12 - Prob. 20RQCh. 12 - Prob. 21RQCh. 12 - Prob. 22RQCh. 12 - Prob. 23RQCh. 12 - Prob. 24RQCh. 12 - Prob. 25RQCh. 12 - Prob. 26RQCh. 12 - Prob. 27RQCh. 12 - Prob. 28RQCh. 12 - Prob. 29RQCh. 12 - Prob. 30RQCh. 12 - Prob. 31RQCh. 12 - Prob. 32RQCh. 12 - Prob. 33RQCh. 12 - Prob. 34RQCh. 12 - Prob. 35RQCh. 12 - Prob. 36RQCh. 12 - Prob. 37RQCh. 12 - Prob. 38RQCh. 12 - Prob. 39RQCh. 12 - Prob. 40RQCh. 12 - Prob. 41RQCh. 12 - Prob. 42RQCh. 12 - Prob. 43RQCh. 12 - Prob. 44RQCh. 12 - Prob. 45RQCh. 12 - Prob. 46FBCh. 12 - Prob. 47FBCh. 12 - Prob. 48FBCh. 12 - Prob. 49FBCh. 12 - Prob. 50FBCh. 12 - Prob. 51FBCh. 12 - Prob. 52FBCh. 12 - Prob. 53FBCh. 12 - Prob. 54FBCh. 12 - Prob. 55FBCh. 12 - Prob. 56SACh. 12 - Prob. 57SACh. 12 - Prob. 58SACh. 12 - Prob. 59SACh. 12 - Prob. 60SACh. 12 - Prob. 61TQCh. 12 - Prob. 62TQCh. 12 - Prob. 64TQCh. 12 - Prob. 65TQCh. 12 - Prob. 66TQCh. 12 - Prob. 67TQCh. 12 - Prob. 68TQCh. 12 - Prob. 71TQCh. 12 - Prob. 72TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- An example of a monosaccharide is ________. a. fructose b. glucose c. galactose d. all of the abovearrow_forward• Calculate the percentage of the total calories per serving that come from total fat.• Based on a 2,000 calorie diet, what percent of the percent daily value for total fat would be consumed per serving? Calculate the percent if the whole container was consumed.• Based on what you know about trans fats, do you think there are hydrogenated oils in this product? Explain.arrow_forwardIf starch can be used as a source of energy, why does the body break it down into glucose?arrow_forward
- Why are the four major groups of dietary fat can be classified in this particular orderarrow_forwardIf both cellulose and starch are just polymers of glucose, why can we only get glucose from starch, while cellulose cannot be digested by our bodies? What is missing for cellulose?arrow_forwardWhy are fats well suited for energy storage in human body?arrow_forward
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardWhat does hydrogenation do to fat? What are trans-fatty acids? In what types of foods are trans-fats typically found? no handwritten answers, please.arrow_forwardAmong the given statements, which ones are correct about the biological functions and commercial uses of carbohydrates? A. Glucose serves as the substrate for photosynthesis in plants. B. Glycogen serves as a repository of glucose in the myocytes. C. The cell wall of plants is reinforced by a polymer of beta-D-glucose. D. Lactose is widely used as filler in tablets and capsules in the pharmaceutical industry. E. Corn extract is commercially hydrolyzed to yield fructose-rich sweeteners.arrow_forward
- Which of the following has fructose in it? Group of answer choices A. glucose B. starch C. glycogen D. sucrose E. cellulosearrow_forwardwhich of the following statements is true? a.) sucrose has no nutritional value b.) sucrose supplies more energy gram per gram, than starch c.) sucrose is a source of glucose d.) sucrose is comprised of two glucose moleculesarrow_forwardExplain why cellulose is a necessary component of our diet even though we don’t digest itarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Nutritional Sciences: From Fundamentals to Food, ...Health & NutritionISBN:9781337486415Author:McGuirePublisher:Cengage
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Nutritional Sciences: From Fundamentals to Food, ...
Health & Nutrition
ISBN:9781337486415
Author:McGuire
Publisher:Cengage
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY