Campbell Biology in Focus; Modified Mastering Biology with Pearson eText -- ValuePack Access Card -- for Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780134433776
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 10TYU
SCIENTIFIC INQUIRY
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (shown in Figure 14.12) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.
Consider the following DNA sequence, which codes for a short polypeptide:
5'-ATGGGCTTAGCGTAGGTTAGT-3'
Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark.
How many amino acids will make up this polypeptide?
Determine the first four anticodons that will be used in order to translate this sequence.
Match each of the following examples with the hypothesis it argues against.
Example
The gene coding for keratin
A gene coding for a tRNA
Three genes, each coding for one of the G protein
subunits (a, ß and y)
A gene that undergoes alternative splicing
Hypothesis
One gene → one polypeptide
One gene→→ one enzyme
One gene → one protein
One gene → one protein
Chapter 14 Solutions
Campbell Biology in Focus; Modified Mastering Biology with Pearson eText -- ValuePack Access Card -- for Campbell Biology in Focus (2nd Edition)
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Fill in the following table: Type of RNA Functions...Ch. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (5th Edition)
A student moving out of a dormitory crouches in correct fashion to lift a heavy box of books. What prime movers...
HUMAN ANATOMY
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forward10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardDNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).arrow_forward
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forwardThe 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. c)Compared to the average stability of mRNA in E.coli, is mRNA in a typical human cell more stable or less stable? Why?arrow_forwardKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forward
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardThe sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).arrow_forwardTranslation requires energy what step(s)? please explain answer B) 30S ribosome subunit binding C) peptide chain elongation A) amino acid attachment to tRNAs both A and B both A and Carrow_forward
- A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of learning how to synthesize stomach tissue in the lab. Subsequently, they determine the exact sequence of amino acids of the protein in its unfolded state, and create a functional mRNA template to translate Protein X in vitro. They manage to translate an exact copy of the polypeptide chain in the lab, but then realize that it takes several days for the protein to fold into its final tertiary structure. In vivo, they observe that several thousand copies of Protein X are folded from polypeptide chains every minute. What is NOT a plausible explanation for this difference in folding times? The in vitro study lacks a key enzyme The temperature in vitro is too low The in vitro study lacks a key tRNA molecule The pH in vitro is too higharrow_forwardOxytocin is a small peptide hormone. It contains a nine amino acid sequence shown below: CYIQNCPLG 33 How many nucleotides would be found in the mRNA for this protein? Suggest an mRNA sequence for the peptide. Write in as 5' XXX 3' (no spaces between nucleotides). Keep in mind, for a protein to be synthesized it needs to include a start codon and a stop codon. Suggest a complementary template DNA sequence based on the MRNA sequences suggested above. Write in as 3' XXX 5' (no spaces between nucleotides).arrow_forwardConsider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license