Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 30P
The sequence at one end of one strand of the Drosophila transposon Mariner is shown below (dots indicate sequences within the transposon):
5′ TTAGTTTGGCAAATATCTCCCTTCCGCCTTTTTGATCTTATGT... 3′
You obtain a mutant bacterial strain tagged with an engineered Mariner transposon, cut the genomic DNA from this strain with the restriction enzyme MboI (whose recognition site is ^GATC), and circularize the resultant DNA fragments by diluting the restriction enzyme digest and adding DNA ligase.
| a. | Design two 17 bp PCR primers that you could use to identify (by inverse PCR) the gene into which the transposon inserted. |
| b. | What DNA sequence will be amplified from the circularized fragments of the mutant genome? Show the extent of this DNA sequence on a map of the genome of the mutant strain, indicating the locations of the transposon insertion and any relevant sites for the enzyme MboI. |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Below is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis.
Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand
A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X:
3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand
Compare the two DNA sequences and look for any differences. Based on what you find
a.
There is no mutation in Strain B compared to Strain A.
b.
After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X.
c.
Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template
d.
Protein X from Strain B will have one amino acid difference that would not affect protein function.
e.
There is a mutation but there will not be any difference in the…
Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant Brassica.
Wildtype DNA3’ CTT AAT GCT CCG AAT CCA 5’ template strand5’ GAA TTA CGA GGC TTA GGT 3’ non-template strand
A new strain (Strain X) of Brassica is identified with the same region of the gene coding for protein Y:3’ CTT AAT GCT GCG AAT CCA 5’ template strand5’ GAA TTA CGA CGC TTA GGT 3’ non-template strand
Compare the sequence of Wildtype with Strain X DNA, and note the following:
Whether there is a mutation.
If there is a mutation, what is the type of mutation (be as specific as possible) and explain the rationale for your decision.
Assuming this is the only difference between the Wildtype and Strain X, describe the potential impact of the mutation on the structure and function of the protein.
The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data?
Chapter 14 Solutions
Genetics: From Genes to Genomes
Ch. 14 - Choose the phrase from the right column that best...Ch. 14 - The unicellular, rod-shaped bacterium E. coli is 2...Ch. 14 - Now that the sequence of the entire E. coli K12...Ch. 14 - Bacterial genomes such as that of E. coli...Ch. 14 - List at least three features of eukaryotic genomes...Ch. 14 - Describe a mechanism by which a gene could move...Ch. 14 - High salt concentrations tend to cause protein...Ch. 14 - Recently, scientists tested the possibility that...Ch. 14 - A recent metagenomic study analyzed the...Ch. 14 - Linezolid is a new type of antibiotic that...
Ch. 14 - A liquid culture of E. coli at a concentration of...Ch. 14 - Pick out the medium i, ii, iii, or iv onto which...Ch. 14 - This problem concerns Fig. 14.14, which...Ch. 14 - In two isolates one is resistant to ampicillin,...Ch. 14 - E. coli cells usually have only one copy of the F...Ch. 14 - In E. coli, the genes purC and pyrB are located...Ch. 14 - DNA sequencing of the entire H. influenzae genome...Ch. 14 - Genes encoding toxins are often located on...Ch. 14 - a. You want to perform an interrupted-mating...Ch. 14 - In Problem 19, do you think that most of the...Ch. 14 - One issue with interrupted-mating experiments such...Ch. 14 - Prob. 22PCh. 14 - Starting with an F- strain that was prototrophic...Ch. 14 - You can carry out matings between an Hfr and F...Ch. 14 - Genome sequences show that some pathogenic...Ch. 14 - Generalized and specialized transduction both...Ch. 14 - This problem highlights some useful variations of...Ch. 14 - A researcher has a Trp auxotrophic strain of E....Ch. 14 - Streptococcus parasanguis is a bacterial species...Ch. 14 - The sequence at one end of one strand of the...Ch. 14 - Scientists who study amino acid biosynthesis...Ch. 14 - Suppose that you could obtain radioactively...Ch. 14 - Prob. 34PCh. 14 - Some scientists are trying to engineer...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data? (please do not copy and paste the answer from below. i don't think it is correct. a. MFAP3L is mostly found in the nucleus in the genome. It is found on chromosome 4 reverse strand. The protein produced by the gene is found in the cell membrane, and it is positioned on the membrane with the carboxyl side of the protein facing the cytosol. b. The MFAP3L gene is transcribed from the telomere to the centromere. c. According to the data, there are 11 different splice forms…arrow_forwardThe following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq) a. Describe in approximate terms the genomic location of MFAP3L. b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere? c. How many alternative splice forms of MFAP3L mRNA are indicated by the data? d. How many different promoters for MFAP3L are suggested by the data?arrow_forwardThe DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGarrow_forward
- in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardThe b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple pigment in plants. What would be the effect of deleting the seven tandem repeats that are located 100,000 bp upstream of the b1 locus in corn?arrow_forwardYou isolate genomic DNA from brain cells and heart cells and use PCR to amplify the promoter region of gene A, known to be methylated under certain circumstances. To determine which cell type has methylation in this region, you treat the DNA with sodium bisulfite, sequence the regions from both brain and heart cells, and compare to the untreated sequence, as shown below. Untreated: ATCCGGCGACG Brain: ATCCGGCGACG Heart: ATCTGGTGACG Given these results, which cell type would you expect to transcribe MORE "A" mRNA?arrow_forward
- The period gene of Drosophila melanogaster encodes for a stretch of Thr-Gly repeated in tandem. In natural populations, the three most common alleles encode for 17, 20 and 23 Thr-Gly repeats. The amplification by PCR of the allele encoding for 20 Thr-Gly repeats produces a fragment of 320 bp. Using the same set of primers, what is the size expected when amplifying the 17 Thr-Gly allele? 317 303 314 302 In a certain species of plant loci A, B and C have an additive effect on the colour of the flower. Alleles A, B, and C are dominant and alleles a, b and c are recessive. Knowing that a plant with genotype AAbbCc has a pink flower, which genotype, among the ones listed below, will produce the same phenotype? Aabbcc. aabbcc. AaBbCc. AABBCc. In pea plants, tall (T) is dominant to dwarf (t) and yellow (Y) is dominant to green (y). In a cross of true-breeding tall yellow peas x dwarf green…arrow_forwardFor Pet41 (choose Pet41 a, b, or c as provided in the image) how would you design the primers (forward and reverse) for the following gene of interest and what restriction enzymes would be used (as shown in the image)? Be sure to explain and elaborate on why selected and how. Gene of Interest: atgggc gacaaaggga 241 cccgagtgtt caagaaggcc agtccaaatg gaaagctcac cgtctacctg ggaaagcggg 301 actttgtgga ccacatcgac ctcgtggacc ctgtggatgg tgtggtcctg gtggatcctg 361 agtatctcaa agagcggaga gtctatgtga cgctgacctg cgccttccgc tatggccggg 421 aggacctgga tgtcctgggc ctgacctttc gcaaggacct gtttgtggcc aacgtacagt 481 cgttcccacc ggcccccgag gacaagaagc ccctgacgcg gctgcaggaa cgcctcatca 541 agaagctggg cgagcacgct taccctttca cctttgagat ccctccaaac cttccatgtt 601 ctgtgacact gcagccgggg cccgaagaca cggggaaggc ttgcggtgtg gactatgaag 661 tcaaagcctt ctgcgcggag aatttggagg agaagatcca caagcggaat tctgtgcgtc 721 tggtcatccg gaaggttcag tatgccccag agaggcctgg cccccagccc acagccgaga 781 ccaccaggca gttcctcatg tcggacaagc ccttgcacct…arrow_forwardA 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold underlined nucleotides are deleted in a common cystic fibrosis (CF) mutation, removing a phenylalanine amino acid from the CFTR protein. 1 AGAGGGTAAA ATTAAGCACA GTGGAAGAAT TTCATTCTGT TCTCAGTTTT 51 CCTGGATTAT GCCTGGCACC ATTAAAGAAA ATATCATCTT TGGTGTTTCC 101 TATGATGAAT ATAGATACAG AAGCGTCATC AAAGCATGCC AACTAGAAGA 151 GGTAAGAAAC TATGTGAAAA CTTTTTGATT ATGCATATGA ACCCTTCACA 201 CTACCCAAAT PCR primers have been designed to amplify fragments within this sequence: Forward: GGATTATGCCTGGCACCATT Reverse: AGTGTGAAGGGTTCATATGC DNA from a CF patient is tested with a PCR assay using a pair of these primers, and the PCR product is found to be 3 bp shorter than that expected from the sequence shown above. What length PCR products (in bp) would you expect in the mother of the CF patient? A. 95 and 92 B. 149 C. 133 and 130 D. 149 and 146 E. 146arrow_forward
- Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'arrow_forwardA portion of the coding sequence of a cloned gene is shown here:5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄This portion of the gene encodes a polypeptide with the aminoacid sequence alanine–proline–aspartic acid–leucine–histidine–histidine–tyrosine–glycine–aspartic acid. Using the method ofsite- directed mutagenesis, a researcher wants to change the leucinecodon into an arginine codon, using an oligonucleotide that is19 nucleotides long. What is the sequence of the oligonucleotidethat should be used? Designate the 5′ and 3′ ends of the oligonucleotidein your answer. Note: The mismatch should be in the middleof the oligonucleotide, and a 1-base mismatch is preferableover a 2- or 3-base mismatch. Use the bottom strand as the templatestrand for this site-directed mutagenesis experiment.arrow_forwardthe one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license