Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 2P
The unicellular, rod-shaped bacterium E. coli is ˜2 μm long and 0.8 μm wide, and has a genome consisting of a single 4.6 Mb circular DNA molecule. The unicellular archaean Methanosarcina acetivorans is spherical
(coccus-shaped) with a diameter of 3 μm and has a 5.7 Mb circular genome. The unicellular eukaryote Saccharomyces cerevisiae is roughly spherical, with a diameter of 5–10 μm. It has a haploid genome of 12 Mb divided among 16 linear chromosomes. Given these descriptions, how could you determine whether a new, uncharacterized microorganism was a bacterium, an archaean, or a eukaryote?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
N-formylmethionine is the amino acid specified by a tRNA molecule carrying the anticodon sequence 5’-CAU-3’ in which of the following organisms?
in the eukaryotes only (like Homo sapiens)
in the archaeobacteria only (like Methanococcus jannaschii)
in both archaeobacteria and eukaryotes
in the eubacteria only (like Escherichia coli)
in both archaeobacteria and eubacteria
During DNA repair in prokaryotes and eukaryotes, which of the following enzymes replaces the damaged nucleotides, that were excised from the DNA strand, by inserting the correct nucleotides?
topoisomerase
DNA polymerase
DNA helicase
an exonuclease
DNA ligase
N-formylmethionine is the amino acid specified by a tRNA molecule carrying the anticodon sequence 5’-CAU-3’ in which of the following organisms?
in the eukaryotes only (like Homo sapiens)
in the archaeobacteria only (like Methanococcus jannaschii)
in both archaeobacteria and eukaryotes
in the eubacteria only (like Escherichia coli)
in both archaeobacteria and eubacteria
Viruses are made up of the same biomolecules as cellular organisms (DNA, RNA, proteins, lipids, etc.). They infect cells and replicate themselves using resources from the host cells. Scientists discovered a previously unknown strain of virus in the tropical Pacific Ocean and it can infect higher-order eukaryotes. Initial analysis revealed that the virus is mainly composed of nucleic acids, proteins, and lipids. Chemical analysis after complete hydrolysis revealed the following building blocks (by weight):
Chemical components
Nucleosides
Amino acids
Lipids, phosphates, and carbohydrates
Percentage by weight
20
30
50
Analysis of percentages of nucleosides yielded the following results (by molar ratio):
Nucleosides
A
G
T
C
U
Percentage by mole
19
29
19
29
4
Researchers determined that the lipids found in the virus form a bilayer membrane surrounding the virus, and are obtained from the membrane of the host cell during virus maturation and exit from host cell.
Further…
Chapter 14 Solutions
Genetics: From Genes to Genomes
Ch. 14 - Choose the phrase from the right column that best...Ch. 14 - The unicellular, rod-shaped bacterium E. coli is 2...Ch. 14 - Now that the sequence of the entire E. coli K12...Ch. 14 - Bacterial genomes such as that of E. coli...Ch. 14 - List at least three features of eukaryotic genomes...Ch. 14 - Describe a mechanism by which a gene could move...Ch. 14 - High salt concentrations tend to cause protein...Ch. 14 - Recently, scientists tested the possibility that...Ch. 14 - A recent metagenomic study analyzed the...Ch. 14 - Linezolid is a new type of antibiotic that...
Ch. 14 - A liquid culture of E. coli at a concentration of...Ch. 14 - Pick out the medium i, ii, iii, or iv onto which...Ch. 14 - This problem concerns Fig. 14.14, which...Ch. 14 - In two isolates one is resistant to ampicillin,...Ch. 14 - E. coli cells usually have only one copy of the F...Ch. 14 - In E. coli, the genes purC and pyrB are located...Ch. 14 - DNA sequencing of the entire H. influenzae genome...Ch. 14 - Genes encoding toxins are often located on...Ch. 14 - a. You want to perform an interrupted-mating...Ch. 14 - In Problem 19, do you think that most of the...Ch. 14 - One issue with interrupted-mating experiments such...Ch. 14 - Prob. 22PCh. 14 - Starting with an F- strain that was prototrophic...Ch. 14 - You can carry out matings between an Hfr and F...Ch. 14 - Genome sequences show that some pathogenic...Ch. 14 - Generalized and specialized transduction both...Ch. 14 - This problem highlights some useful variations of...Ch. 14 - A researcher has a Trp auxotrophic strain of E....Ch. 14 - Streptococcus parasanguis is a bacterial species...Ch. 14 - The sequence at one end of one strand of the...Ch. 14 - Scientists who study amino acid biosynthesis...Ch. 14 - Suppose that you could obtain radioactively...Ch. 14 - Prob. 34PCh. 14 - Some scientists are trying to engineer...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In Figure 6-13, explain at the protein level why this heterokaryon can grow on minimal mediumarrow_forwardAn E. coli colony grew on minimal medium supplemented with arginine and leucine. However, bacteria from this colony are unable to grow and form colonies on minimal medium supplemented with arginine and methionine. What is the genotype of the bacteria in this E. coli colony?arrow_forwardThe antibiotic kanamycin binds to the small ribosomal subunit of bacteria and interferes with protein synthesis, and the diphtheria toxin binds to the eukaryotic elongation factor EF2 and prevents translocation of the ribosome during protein synthesis. Suppose that an archaeobacterial infection is detected in a person. Could kanamycin and diphtheria toxin be used for treatment of the infection? Why?arrow_forward
- Write a result paragraph of the isolation and purification of bacteriophage with E. coli Top10 with the following results: At 10^-1 to 10^-3 no plaques were formed. At 10^-4 too numerous plaques were formed. At 10^-5, 10^-6 and 10^-7 countable plates of 22, 7 and 1 respectively. At 10^-8 and 10^-9 no plaques formed but present of host bacteria.arrow_forwardYou wish to produce a high-value protein using recombinant DNA technology. Would you try to develop a chemical defined medium or a complex medium? Why? Explain what semiconservative replication means. Give characteristic dimensions for each of these organisms: E. coli Yeast (S. cerevisiae) Liver cell (hepatocyte) Plant cell .What are the differences in cell envelope structure between gram-negative and gram-positive bacteria? These differences become important if you wish to genetically engineer bacteria to excrete proteins into the extracellular fluid.arrow_forwardFor the following sets of partial diploid bacteria, how do I fill out this table? I am not sure how to tell the difference between inducible and constitutive?arrow_forward
- Refer to the sequence below to answer the following questions. 5’- CACTTTTCAACTTGGCAGAAGCAATGTATCTCCGGATATAATCGCTTTCGAATTCG- 3’ 3’- GTGAAAAGTTGAACCGTCTTCGTTACATAGAGGCCTATATTAGCGAAACTTAAGC- 5’ Is the sequence from a bacterial or a eukaryotic cell?Identify the characteristics that support the rationale for your decision. Which DNA strand serves as the template for transcription?arrow_forwardThe high rate of bacterial metabolism requires a high surface-to-volume ratio. Why does the surface/volume ratio affect the maximum metabolic rate? 2) Calculate the surface-to-volume ratio of the spherical Neisseria gonorhoe bacterium (0.5 µm in diameter). Compare this with the surface-to-volume ratio of the large eukaryote ameba (150 mm in diameter). 3) An enzyme isolated from rat liver has 193 amino acids and is encoded by a 1440 base pair long gene. Explain the connection between the amino acid number of the enzyme and the number of nucleotide pairs in its gene.arrow_forwardIn Hershey-Chase experiment, bacteriophages protein coats were tagged with radioactive isotope S-32. These phages were used to infect E. coli cells and the cells were further centrifuged to form pellets. Why was the radioactivity level of S-32 found greater outside the cells compared to the E. coli cell pellets? Explain briefly. If the experiment is repeated in the same manner but this time the phage protein coats are labelled with isotope X and the phage DNA with isotope Y, which isotope’s radioactivity will be found in greater amounts in the E. coli cell pellets after centrifugation? Explain briefly.arrow_forward
- Recombinant protein production by a genetically modified Escherichia coli strain is proportional to cell growth. Ammonia is used as a nitrogen source for aerobic glucose respiration. The recombinant protein has the general formula CH1,55O0,31N0,25, while that of the cellular biomass is CH1,77O0,49N0,24. The biomass yield from glucose equals 0.50 g/g, while the recombinant protein yield from glucose corresponds to 20% of the cell yield from substrate.a) How much ammonia is required? What is the oxygen demand? (b) If the biomass yield remains the same, what are the ammonia and oxygen requirements for a wild-type strain of E. coli, with cell biomass of the same elemental composition, but unable to synthesize the recombinant protein? (c) On an industrial scale, cultivation takes place in a continuous fermenter at 28°C and the desired recombinant protein production rate is 7 g/h. Since the viscosity of the culture broth is considerable, the energy input due to agitation cannot be neglected.…arrow_forwardWhich of the following attributes is true about bacterial ribosomes? please look at the 2 attached pictures for the multiple choice answer choices.arrow_forwardWhich of the following statements is correct? The prokaryotic ribosomal RNAs are 18S, 23S, and 28S The eukaryotic ribosome is 100S and consists of 60S and 40S subunits The prokaryotic ribosome has 4 subunits The eukaryotic ribosomal RNA are 28S, 18S, 5.8S and 5S The prokaryotic ribosome is 90S, and consists of 50S and 40S subunitsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license