GENETIC ANALYSIS: INTEGRATED - ACCESS
3rd Edition
ISBN: 9780135349298
Author: Sanders
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 16P
The restriction enzymes Xho
Xho
Sal
Can the sticky ends created byXho
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You are studying a protein that contains the peptide sequence
RDGSWKLVI. The part of the DNA encoding this peptide is included
in the sequence shown below.
5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3'
3'-GCACTGCCGAGCACCTTCGATCAGTAG-5'
This sequence does not contain any BamHI restriction enzyme sites.
The target sequence for the BamHI restriction nuclease is GGATCC.
Your goal is to create a BamHI site on this plasmid by manipulating the
DNA sequence, without changing the coding sequence of the protein. How
would you do this, ie what would the new sequence be?
The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19.
Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII.
Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.
Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites
of cleavage indicated by arrows.
Table 1
Enzyme name
Recognition sequence and position of cut
5'GIAATTC3
5'G!GATCC3'
5'GIGTACC3
5'GCIGGCCGC3'
5'IGATC3'
5'GGTACIC3'
5'ALGATCT3
EcoRI
ВатHI
Аcс651
Notl
Sau3A
Kpnl
BglII
(i)
Which restriction enzyme(s) produce blunt ends?
(ii)
Are there any pair of neoschizomers in the list? Explain.
(iii)
Are there any pair of isocaudomers in the list? Explain.
Chapter 15 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
Ch. 15 - 15.1 What purpose do the bla and lacZ genes serve...Ch. 15 - The human genome is 3109 bp in length. How many...Ch. 15 - 15.3 Ligase catalyzes a reaction between the...Ch. 15 - You have constructed four different libraries: a...Ch. 15 - Using the genomic libraries in Problem 4, you wish...Ch. 15 - The human genome is 3109bp. You wish to design a...Ch. 15 - 15.7 Using animal models of human diseases can...Ch. 15 - 15.8 Compare methods for constructing homologous...Ch. 15 - 15.9 Chimeric genefusion products can be used for...Ch. 15 - 15.10 Why are diseases of the blood simpler...
Ch. 15 - Injection of double-stranded RNA can lead to gene...Ch. 15 - Compare and contrast methods for making transgenic...Ch. 15 - 15.13 It is often desirable to insert cDNAs into a...Ch. 15 - 15.14 A major advance in the s was the development...Ch. 15 - 15.15 The bacteriophage lambda genome can exist in...Ch. 15 - 15.16 The restriction enzymes Xho and Sal cut...Ch. 15 - 15.17 The bacteriophage has a single-stranded DNA...Ch. 15 - 15.18 To further analyze the CRABS CLAW gene (see...Ch. 15 - You have isolated a genomic clone with an EcoR I...Ch. 15 - 15.20 You have identified a cDNA clone that...Ch. 15 - 15.21 You have isolated another cDNA clone of the...Ch. 15 - 15.22 You have identified five genes in S....Ch. 15 - You have generated three transgenic lines of maize...Ch. 15 - 15.24 Bacterial Pseudomonas species often possess...Ch. 15 - 15.25 Two complaints about some transgenic plants...Ch. 15 - 15.26 In Drosophila, lossoffunction Ultrabithorax...Ch. 15 - Prob. 27PCh. 15 - The highlighted sequence shown below is the one...Ch. 15 - Vitamin E is the name for a set of chemically...Ch. 15 - The RAS gene encodes a signaling protein that...Ch. 15 - 15.31 You have cloned a gene for an enzyme that...Ch. 15 - 15.32 About of occurrences of nonautoimmune type...Ch. 15 - Describe how having the Cas 9 gene at a genomic...Ch. 15 - 15.34 Would a gene drive system spread rapidly...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a bacterial restriction enzyme. What is the recognition sequence? Which enzyme will cut this sequence and where in the sequence? What is the sequence of the 'sticky end' produced by this enzyme? 5’ CCGAGAAGCTTAC 3’ 3’ GGCTCTTCGAATG 5’arrow_forwardGiven the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.arrow_forward#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:arrow_forward
- This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction endonuclease Nhel are 7, 69 and 160. What are the sizes of the restriction fragments produced? Check all that apply. p SAGE Nhel 7 250 bp Nhền 160 Nhel 69 62 69 91 160 97arrow_forwardThe following is a section of the gene coding for bovine rhodopsin along with several restriction endonucleases, their recognition sequences, and their hydrolysis sites. Which endonucleases will catalyze cleavage of this section of DNA? 5-GCCGTCTACAАСССGGTCATCTAАСТАТСАТGATCААСАAGCAGTTCCGGAACT-3' Recognition Sequence Recognition Sequence Enzyme Enzyme AG | CT TGG | CCA CG I CG GG | CC CI CGG | GATC GC | GGCCGC GAGCT | C Alul Hpall Ball Mbol FnuDII NotI HealII Sadarrow_forward1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200arrow_forward
- To estimate the number of cleavage sites in a particular piece of DNA with a known size, you can apply the formula N/4n where N is the number of base pairs in the target DNA and n is the number of bases in the recognition sequence of the restriction enzyme. If the recognition sequence for BamHI is GGATCC and the l phage DNA contains approximately 48,500 bp, how many cleavage sites would you expect?arrow_forwardBased on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forwardFor the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).arrow_forward
- A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bparrow_forwardThe following illustrates a jagged double-strand DNA break resulting from Cas9 cleavage that occurred in the first step of genome editing using CRISPR-Cas9 technology: 5'-GCGCCGTCC 3'-CGCGGC CTGTCAGGCGACACT-3' AGGGACAGTCCGCTGTGA-5' Which of the double-stranded DNA sequences listed below (A-D) is expected to result from repair of the break above via non-homologous end joining? Note: this question is not asking what kinds of mutations result from NHEJ repair of Cas9 cleavage in general, but specifically what is expected to result from repair of the jagged cut illustrated above? In the answer choices below, sequences that are the same in all four options are shown in bold to help you spot the differences. A. 5'-GCGCCGCTGTCAGGCGACACT-3' 3'-CGCGGCGACAGTCCGCTGTGA-5' B. 5'-GCGCCGTCTGTCAGGCGACACT-3 3'-CGCGGCAGACAGTCCGCTGTGA-5' C. 5'-GCGCCGTCCCTGTCAGGCGACACT-3' 3'-CGCGGCAGGGACAGTCCGCTGTGA-5' D. 5'-GCGCCGAGACTGTCAGGCGACACT-3' 3'-CGCGGCTCTGACAGTCCGCTGTGA-5'arrow_forwardAfter characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License