Concept explainers
You have isolated another cDNA clone of the CRABS CLAW gene from a cDNA library constructed in the vector shown in Problem
Which of the sequence shown below represents the
Will the long stretch of T residues in the T
Can you identify which sequences are derived from the vector (specifically the MCS) and which sequences are derived from the cDNA clone?
Can you identify the start of the coding region in the
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 15 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
- The human hexokinase enzyme has the same function as the bacterial hexokinase enzyme but is somewhat different in its amino acid sequence. You have obtained a mutant bacterial strain in which the gene for hexokinase is missing. If you introduce into your mutant strain a DNA plasmid engineered to contain the DNA coding sequence of the human hexokinase gene, what must you also include? a)The human hexokinase promoter b)The bacterial hexokinase promoter c)Both the human and bacterial promoters d)You cannot engineer a bacteria to produce a human enzymearrow_forwardAfter Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNAarrow_forwardKnowing that you are using HindIII and EcoRI to cut your plasmids, and that those two enzymes cut within the MCS, use the map of pUC19 provided below to compute: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19? What will be the sizes of the 2 restriction fragments if the approximately 317 bp RT-PCR product (insert from WT satC dimer) was ligated successfully into the SmaI site? What will be the sizes of the 2 restriction fragments if TWO approximately 317 bp RT-PCR products (2 ligated inserts from WT satC dimer) were ligated into the SmaI site?arrow_forward
- You have isolated a cDNA clone encoding a protein of interest in a higher eukaryote. This cDNA clone is not cleaved by restriction endonuclease EcoRI. When this cDNA is used as a radioactive probe for blot hybridization analysis of EcoRI-digested genomic DNA, three radioactive bands are seen on the resulting Southern blot. Does this result indicate that the genome of the eukaryote in question contains three copies of the gene encoding the protein of interest? Explain.arrow_forwardClone number in this case is number 196 which is shown in the images. State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)arrow_forwardWhich of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forward
- Recombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and D gene segments which undergo recombination to generate the final V region coding exon. Some of these have 12-nucleotide spacers between the heptamer and nonamer, and others have 23-nucleotide spacers. The reason recombination signal sequences come in these two forms is: To ensure the correct assembly of gene segments so that a VH recombines to a DH and not to another VH, for instance To ensure that the heptamer and nonamer are found on the same face of the DNA double helix To ensure that alpha, lambda, and heavy chains recombine within a locus and not between loci To ensure that alpha, lambda, and heavy chain gene segments do not undergo recombination with non-immunoglobulin genes To ensure that the RAG recombinase cuts the DNA between the last nucleotide of the heptamer and the coding sequencearrow_forwardIn this western blot, the levels of phosphorylated TBK (PTBK) decrease with increasing amounts/expression of the viral protein (VP). Figure description: Increasing amounts of a plasmid expressing the viral protein (0.5, 1, or 2ug) were cotransfected with TBK1 expression plasmid. Cells were harvested 24 h post-transfection and analyzed for phosphorylated TBK1 (anti- TBK1 Ser172), total TBK1 (anti-TBK1), B-actin (anti-B-actin), and viral protein (anti-VP) expression by Western blot analysis. VP PTBK1 (S172) TBK1 actin Virus proteins O True O Falsearrow_forwardAfter characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG…arrow_forward
- You are attempting to clone a 3 kb gene from the bacterial sp Microbacterium foliarum into the EcoRI site of the 6.0 kb plasmid shown. If you restrict the plasmid with EcoR1, how many bands will you obtain on agarose gel electrophoresis? Compare it with a plasmid in which no gene has been inserted. Draw a representative agarose gel showing the bands, and the direction of current flow as well point out the positive and negative electrodesarrow_forwardAfter Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forwardYou are using Drosophila as a model system to investigate eye development. You do positional cloning to isolate a mutant gene called eyeless (eyl), which causes flies to develop with reduced sized eyes when homozygous. Using several DNA markers from the candidate interval as probes for colony hybridization to a CDNA library, you obtain a 10 Kb cDNA insert cloned into the unique EcoRI site of a 3.5 Kb plasmid vector. a. Briefly describe how would you use the Drosophila eyl cDNA clone to identify a clone from a mouse genomic DNA library that is homologous to the Drosophila eyl gene? b. You isolate a clone of mouse genomic DNA that appears to be homologous to the Drosophila eyl gene. After DNA sequencing of a small piece of the mouse genomic clone, you use the DNA sequence to search the mouse genome database. You find that there is a SNP locus (n1234) that does NOT cause an RFLP in this genomic clone. You have identified several breeding lines of mice, each having been bred for several…arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)