Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 9TYK
Which of the following is true of RNA processing?
- a. Exons are excised before the mRNA is translated.
- b. Signal peptides are added to the 5ʹ end of the transcript.
- c. Assemblies of protein and small RNAs, called spliceosomes, may catalyze splicing.
- d. Large quantities of rRNA are assembled into ribosomes.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
Within a cell, the amount of protein made using a given mRNA molecule depends partly on
A. the presence of certain transcription factors.
B. the rate at which the mRNA is degraded.
C. the degree of DNA methylation.
D. the number of introns present in the mRNA.
please explain which is correct and incorrect and why
Chapter 17 Solutions
Study Guide for Campbell Biology
Ch. 17 - a. In what three ways does RNA differ from DNA? b....Ch. 17 - Prob. 2IQCh. 17 - Prob. 3IQCh. 17 - How does the mRNA that leaves the nucleus differ...Ch. 17 - Prob. 5IQCh. 17 - In the following diagrams of polypeptide...Ch. 17 - What determines if a ribosome becomes bound to the...Ch. 17 - Define the following terms and explain what type...Ch. 17 - You have been introduced to several types of RNA...Ch. 17 - Prob. 2SYK
Ch. 17 - What is the genetic code? Explain redundancy and...Ch. 17 - Prepare a concept map showing the types and...Ch. 17 - Prob. 1TYKCh. 17 - Transcription involves the transfer of information...Ch. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - Which of the following is a statement of the...Ch. 17 - Prob. 6TYKCh. 17 - Prob. 7TYKCh. 17 - Prob. 8TYKCh. 17 - Which of the following is true of RNA processing?...Ch. 17 - Prob. 10TYKCh. 17 - Prob. 11TYKCh. 17 - Prob. 12TYKCh. 17 - Prob. 13TYKCh. 17 - Prob. 14TYKCh. 17 - What type of bonding is responsible for...Ch. 17 - Prob. 16TYKCh. 17 - Prob. 17TYKCh. 17 - Prob. 18TYKCh. 17 - Prob. 19TYKCh. 17 - Prob. 20TYKCh. 17 - Prob. 21TYKCh. 17 - Prob. 22TYKCh. 17 - Prob. 23TYKCh. 17 - Prob. 24TYKCh. 17 - Prob. 25TYKCh. 17 - Prob. 26TYKCh. 17 - Prob. 27TYKCh. 17 - Prob. 28TYK
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have how many exons? a) four exons b) five exons c) six exons d) there could be multiple mRNA that contain between one and six exonsarrow_forwardA scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene for this enzyme, and the scientist extracts mRNA transcribed from this gene as well as protein translated from it. The gene has three introns in its sequence. If the researcher compares mRNA from inside the nucleus to mRNA from the ribosomes, what will be found? A. less mRNA in the nucleus B. shorter mRNA in the ribosomes C. identical mRNAs in both places D. mRNA covalently attached to protein in the nucleusarrow_forwardAt what point in gene expression do you think the process could be regulated? Select all that apply: a) Before transcription begins. b) During the process of transcription. c) During the process of translation. d) After translation ends.arrow_forward
- How would you make a copy of DNA from an mRNA transcript and what is this molecule called?arrow_forwardA protein is normally secreted from the cell. A team of scientists attempts to redirect this protein to the inside of the nucleus by mutating the sequence of the gene. Unfortunately, after this mutation, the protein is no longer secreted, but it is now localized to the cytosol and not the nucleus. Briefly answer the two questions below: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What additional mutation must be made by the scientists to redirect this protein to the nucleus? Explain your reasoningarrow_forwardWhat is the genetic code? a. The relationship between a three-base codon sequence and an amino acid or the end of translation b. The entire base sequence of an mRNA molecule c. The entire sequence from the promoter to the terminator of a gene d. The binding of tRNA to mRNAarrow_forward
- Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What types of mutations would prevent ρ-dependent termination? C. If a mutation prevented transcriptional termination at the end of a gene, where would gene transcription end? Or would it end?arrow_forwardWhat is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your own words, explain what this enzyme does.arrow_forwardDescribe how the sequence of nucleotides in mRNA codes for the amino acids of a protein. How can the insertion or deletion of even one nucleotide in mRNA cause significant changes to the protein that results?arrow_forward
- Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forwardWhich of the following is the best description of a transcription factor? A. A protein that brings the correct nucleotides to RNA polymerase B. A protein that binds to specific DNA sequences C. A DNA sequence that binds to RNA polymerase D. A modification that is made to mRNA to help it be exported from the nucleus. .arrow_forwardAccording to the adaptor hypothesis, is each the following statementstrue or false?A. The sequence of an anticodon in a tRNA directly recognizes acodon sequence in mRNA, with some allowance for wobble.B. The amino acid attached to the tRNA directly recognizes acodon sequence in mRNA.C. The amino acid attached to the tRNA affects the binding of thetRNA to a codon sequence in mRNA.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY