Concept explainers
- a. In what three ways does RNA differ from DNA?
- b. Fill in the following sequence in the flow of genetic information, often called the central dogma. Above each arrow, write the name of the process involved.
Figure 17.6 The codon table for mRNA. The three
VISUAL SKILLS A segment in the middle of an mRNA has the sequence 5′-AGAGAACCGCGA-3′. Using the codon table, translate this sequence, assuming the first three nucleotides are a codon.
a.
To determine: Three ways in which ribonucleic acid (RNA) differs from deoxyribonucleic acid (DNA).
Introduction: Nucleic acids are the major organic molecules of all living organisms. Nucleic acids are made of three major components, such as nitrogenous base, pentose sugar, and phosphate group. The two major nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA carries the genetic information from one generation to other generation. DNA controls the synthesis of RNA in the cell. RNA is responsible for the synthesis of protein molecules.
Explanation of Solution
Three ways in which DNA differ from RNA are given below:
Criteria | DNA | RNA |
Pentose sugar | DNA contains deoxyribose pentose sugar. | RNA contains ribose pentose sugar. |
Nitrogenous base | DNA has 4 nitrogenous bases, namely adenine, cytosine, guanine, and thiamine. | RNA has 4 nitrogenous bases, namely adenine, cytosine, guanine, and uracil. |
Strand | DNA is double-stranded. | RNA is single-stranded. |
b.
To fill and name: The given sequence in the flow of genetic information and the process involved in it.
Introduction: The central dogma of biology explains the flow of information from genes to protein by two processes. These two processes are transcription and translation.
Explanation of Solution
The given sequence in the flow of genetic information and the process involved in it is as follows:
Transcription is a process in which a DNA sequence is converted into a functional piece of RNA. In the initiation of transcription, RNA polymerase binds to the sequence of DNA, and then the unbinding of DNA strand takes place. RNA polymerase adds the RNA bases to the DNA that creates a single strand of mRNA. RNA polymerase detaches from the sequence, and the newly formed sequence of mRNA is released into the nuclear fluid, and then it leaves the nucleus.
After the transcription, the newly formed mRNA enters the cytosol. In the cytosol, processed mRNA associates with many ribosomes. The complex of ribosome-mRNA starts the process of translation. At the initiation of translation, anticodons that appear on tRNA attaches with the mRNA codon. This attachment of tRNA and mRNA codon corrects the orientation of newly arrived amino acids. These amino acids are linked together by a peptide bond, and a peptide chain starts to grow.
Transcription is the formation of RNA from a DNA sequence and through the process of translation, protein is formed from the RNA.
Want to see more full solutions like this?
Chapter 17 Solutions
Study Guide for Campbell Biology
- State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCAarrow_forwardB. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changedarrow_forward(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?arrow_forward
- 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.arrow_forwardThe codon is found on mRNA? True or False?arrow_forwardGive typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’arrow_forward
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwarda) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forwardBelow is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3arrow_forward
- Briefly describe the process of protein making.include the functions of mRNA ,tRNA, and rRNAarrow_forwardNumber the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.arrow_forwardTranscribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: Codon: Anitcodon: Amino Acids:arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education