Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 18.2PS
The Genetic Code in a T-Even Phage. A portion of a polypeptide produced by bacteriophage T4 was found to have the following sequence of amino acids:
…Lys-Ser-Pro-Ser-Leu-Asn-Ala…
Deletion of a single
…Lys-Val-His-His-Leu-Met-Ala…
- (a) What was the nucleotide sequence of the mRNA segment that encoded this portion of the original polypeptide?
- (b) What was the nucleotide sequence of the mRNA encoding this portion of the mutant polypeptide?
- (c) Can you determine which nucleotide was deleted and which was inserted? Explain your answer.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:
a)requires all four ribonucleoside triphosphates and a DNA template.
b)can extend an RNA chain and initiate a new chain.
c)recognizes specific start signals in DNA.
d)produces an RNA polymer that begins with a 5'-triphosphate.
e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Choose your choice of 5 amino acidsDon't forget - the start code and the stop code
Put them in the order you wantwrite their codon (from the table below - this represents your mRNA) and their initial (which represents amino acid)
At this moment, you create from this message, the DNA triples (reminder: A, T, C, G) by making the complement
Then, from this message, you create the tRNA anticodons (reminder: A, U, C, G) by making the complement
(arrêt=stop and depart= start) please I need all the steps, thank you! :)
Bacteria or Eukaryotes?
Formation of a termination loop within the transcript
Alternative splicing of transcripts
Translation beginning before transcription is complete
Cleavage following the AAUAAA signal
Direct binding of RNA polymerase to promoter
Chapter 18 Solutions
Becker's World of the Cell (9th Edition)
Ch. 18 - Suppose a triplet on the template strand of a...Ch. 18 - Of these three techniques, which one provides the...Ch. 18 - Compare and contrast bacterial and eukaryotic...Ch. 18 - The autoimmune disease systemic lupus...Ch. 18 - QUANTITATIVE Triplets or Sextuplets? In his Nobel...Ch. 18 - The Genetic Code in a T-Even Phage. A portion of a...Ch. 18 - Frameshift Mutations. Each of the mutants listed...Ch. 18 - Prob. 18.4PSCh. 18 - Locating Promoters. The following table provides...Ch. 18 - Prob. 18.6PS
Ch. 18 - Starting Up. Refer to Figure 18-30, which depicts...Ch. 18 - RNA Processing. The three major classes of RNA...Ch. 18 - Prob. 18.9PSCh. 18 - Antibiotic Inhibitors of Transcription. Rifamycin...Ch. 18 - Prob. 18.11PSCh. 18 - Cloning Conundrum. Using established recombinant...Ch. 18 - Nucleoli. Indicate whether each of the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Recombination in Immunoglobulin Genes If recombination between a Vkand Jkgene formed a CCA codon at codon 95 (Figure 28.41), which amino acid would appear at this position?arrow_forwardMultiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.arrow_forwardGenetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?arrow_forward
- Word Bank -- NOTE: Some words are not used. nucleotides nucleus adenine cytosine guanine uracil thymine sugar transfer messenger amino acids ribosome mitochondria base phosphate promoter hydrogen chromosomes DNA translation terminator transcription polypeptide An enzyme is needed for the Krebs Cycle. It will be made following the directions contained in a gene of one of the __29__ found in the __30__ of the cell. A portion of the double strand of __31__ splits apart between the weak__32__bonds holding the bases together. This portion contains the code for building the enzyme. The code message begins…arrow_forwardOnly answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesisarrow_forwardYes or no. No need explanation. dapi sho sperm and testes after feeding planarians with luciferase dsrna does cdna generate from genomic dna? Are 5' and 3' regions intronic sequence?arrow_forward
- Yes or no? No explanation. rna polymerase are recruiting to start transcription but promoters are DNA sequence. Taq polymerase is enzyme and can synthesize dna at 72 degrees. dna reads 5 to 3 and polymerase reads template 3 to 5.arrow_forwardPart 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5. a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3? c) How many bands of DNA are there in lane 5? d) There would be 2 bands of DNA in lane 4. How big are they? e) Which lane…arrow_forwardDNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:arrow_forward
- The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).arrow_forwardMultiple choice DNA polymerases can only elongate from: -Free 3’ hydroxyl groups -The area ahead of the sliding clamp -Okazaki Fragments -The 5’ end of the lagging strand and The ______ of the EGFR allows coupling with another monomer. -Dimerization arm -Conformation arm -Polarization arm -Signaling armarrow_forwardDNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License