Concept explainers
(a)
To determine: Whether snRNA (small nuclear ribose
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(b)
To determine: Whether spliceosome used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(c)
To determine: Whether snRNP (small nuclear ribonucleoprotein) used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(d)
To determine: Whether splice sites used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(e)
To determine: Whether lariat used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
Want to see the full answer?
Check out a sample textbook solutionChapter 18 Solutions
Becker's World of the Cell (9th Edition)
- how many amino acids and omega bonds? How many amino acids appear to have undergone a post-translational modification? how many amino acids which would be classified as polar uncharged amino acids?arrow_forwardCentral Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?arrow_forwardReplication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?arrow_forward
- DNA: Why does histone modifications matter?arrow_forwardRNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?arrow_forwardExploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled ‘Biological Assembly.� click “More Images.� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?arrow_forward
- mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.arrow_forward(a) Write a possible sequence for an mRNA segment coding for apamine.(b) Do you think apamine is synthesized in the form, or is it more likely a product of proteolytic cleavage of a larger peptide? Explain.arrow_forwardCalculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.arrow_forward
- True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.arrow_forwardRemember remove the introns! All introns start with GT and end with AG.arrow_forward15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following PTMs: N-linked glycosylation, phosphorylation, ubiquitination, or GPI-anchor. Clearly indicate your choice, then address the following: (a) How is the PTM attached to the protein of interest? At which amino acid residue(s)? What enzyme(s) is involved, if any? (b) Is the PTM relatively stable or highly dynamic? Explain. How does the PTM become detached from the protein of interest? What enzyme(s) is involved, if any? (c) What is the function of the PTM? Provide one specific example.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning