Bio 121 Campbell Biology Truman College
17th Edition
ISBN: 9781323670637
Author: Urry, Cain
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 18.2, Problem 2CC
MAKE CONNECTIONS Ø Speculate about whether the same enzyme could methylate both a histone and a DNA base. (See Concept 5.4.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene
. You obtain the DNA sequence of a mutant of a 2-kb genein which you are interested and it shows base differencesat three positions, all in different codons. One is a silentchange, but the other two are missense changes (they encode new amino acids). How would you demonstratethat these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)
MAKE CONNECTIONS Although the proteins that cause theE. coli chromosome to coil are not histones, what propertywould you expect them to share with histones, given theirability to bind to DNA (see Figure 5.14)?
Chapter 18 Solutions
Bio 121 Campbell Biology Truman College
Ch. 18.1 - How does binding of the trp corepressor to the trp...Ch. 18.1 - Describe the binding of RNA Polymerase,...Ch. 18.1 - WHAT IF? A certain mutation in E. coli changes...Ch. 18.2 - In general, what are the effects of histone...Ch. 18.2 - MAKE CONNECTIONS Speculate about whether the same...Ch. 18.2 - Compare the roles of general and specific...Ch. 18.2 - Once mRNA encoding a particular protein reaches...Ch. 18.2 - WHAT IF? Suppose you compared the nucleotide...Ch. 18.3 - Compare miRNAs and siRNAs, including their...Ch. 18.3 - WH AT IF? Suppose the mRNA being degraded in...
Ch. 18.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 18.4 - MAKE CONNECTIONS As you learned in Chapter 12,...Ch. 18.4 - MAKE CONNECTIONS Explain how the signaling...Ch. 18.4 - How do fruit fly maternal effect genes determine...Ch. 18.4 - Prob. 4CCCh. 18.5 - Prob. 1CCCh. 18.5 - Under what circumstances is cancer considered to...Ch. 18.5 - MAKE CONNECTIONS The p53 protein can activate...Ch. 18 - Compare and contrast the roles of a corepressor...Ch. 18 - Describe what must happen in a cell for a gene...Ch. 18 - Why are miRNAs called noncoding RNAs? Explsin how...Ch. 18 - Describe the two main processes that cause...Ch. 18 - Compare the usual functions of proteins encoded by...Ch. 18 - If a particular operon encodes enzymes for making...Ch. 18 - Muscle cells differ from nerve cells mainly...Ch. 18 - The functioning of enhancers is an example of (A)...Ch. 18 - Cell differentiation always involves (A)...Ch. 18 - Which of the following is an example of...Ch. 18 - What would occur if the repressor of an inducible...Ch. 18 - Absence of bicoid in mRNA from a Drosophila egg...Ch. 18 - Which of the following statements about the DNA in...Ch. 18 - Within a cell, the amount of protein made using a...Ch. 18 - Prob. 10TYUCh. 18 - draw it The diagram below shows five genes,...Ch. 18 - Prob. 12TYUCh. 18 - Prob. 13TYUCh. 18 - SCIENCE. TECHNOLOGY, AND SOCIETY Trace amounts of...Ch. 18 - WRITE ABOUT A THEME: INTERACTIONS In a Short essay...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE The flashlight fish has...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forwardVISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forward. In bacterial genes, as soon as any partial mRNA transcriptis produced by the RNA polymerase system, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5′ and 3′ ends of mRNA,the COOH and NH2 ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes?arrow_forward
- What is the Central Dogma of biology?•. Name FOUR polymers in your body rightnOW.‡. DRAW the new DNA codon for your NEWamino acid (5'-3")gDRAW the new mRNA codon for yournew amino acid (5'-3°).arrow_forward. Where are the Ran-GAP and Ran-GEF proteins predominately located? They are both inside the nucleus They are both outside the nucleus Ran-GAP is on the outside of the nucleus, while Ran-GEF is on the inside of the nucleus RanGAP is on the inside of the nucleus, while RanGEF is on the outside of the nucleus They are both cytosolic (found in the cytoplasm)arrow_forwardBIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…arrow_forward
- Explore: Codons Found in Messenger RNA Second Base U C A Cys u Cys c Stop A G Phe Ser Tyr Tyr Stop Stop His Phe Ser Leu Ser Leu Ser Trp Leu Pro Arg Arg Arg G Leu Pro His Leu Pro Gin Leu Pro Gln Arg le Thr Asn Ser U A lle Thr Asn Ser le Thr A Lys Lys Arg Arg Gly Gly A Met Thr Val Ala Asp Val G Val Ala Asp Glu Ala Gly Gly Val Ala Glu Mutation #1: • Change the Mutation to RED Original DNA Sequence: TACAC CTTGG CCGACGACT mRNA Sequence: A UGUG GA ACCG CUG C UGA Amino Acid Sequence: MET -TRP- ASN - ARG- CYS - (STOP) Mutated TAC ATC TTG GCG ACG ACT DNA mRNA AUG Amino Acid МЕТ- MET - Will this mutation have an effect? What kind of mutation is this? First Base Third Basearrow_forwardMAKE CONNECTIONS The restriction site for an enzymecalled PvuI is the following sequence:5’-CGATCG-3’3’-GCTAGC-5’arrow_forwardE 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower? GTGCATCTGACTCCTGAGGAGAAG САCGTAGAСTGAGGACTССТСТТС ... ... DNA ... ... (transcription) GUGCAUCUGACUCCUGAGGAGAAG RNA •.. ... (translation) VHLT PE K protein ... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a UPPER b. LOWERarrow_forward
- Content → X # 3 -fleet01-xythos.content.blackboardcdn.com/blackboard.learn.xythos.prod/5a3683e2386d2/11826556?X-Blackboard-S3-Bucket-blackb... 1_12_2021 Bb 11826570 $ 10. The amino terminus of a wildtype enzyme in yeast has the amino acid sequence Met-Leu-His-Tyr-Met-Gly-Asp-Tyr-Pro A mutant, X, is found that contains an inactive form of the enzyme with the sequence 4 CO G Search or type URL X 4 | 7 | - 125% + | @ Met-Gly-Asp-Tyr-Pro at the amino terminus and a wildtype sequence at the carboxyl terminus. A second mutant, Y, also lacks enzyme activity, but a full-length protein is not observed. Instead, mutant Y makes a short peptide containing just 3 amino acids. What mutations could account for these changes in mutant X and mutant Y? As part of your answer, show the sequences of the genes encoding the wildtype proteins and the 2 mutant proteins, and indicate in the wild type sequence where the mutations that gave rise to X and Y actually occurred. What is the sequence of the…arrow_forwardEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardMacmillan Learning Label the structural features of the yeast phenylalanine tRNA. Answer Bank region that carries the amino acid at its end Extra arm 5' end region that contains the bases ribothymidine and pseudouridine region that contains the base dihydrouridine region that contains the anticodon, which base pairs with the mRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY