CAMPBELL BIO TXT+MOD.MAST.BIO W ETEXT
10th Edition
ISBN: 9781323257937
Author: Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Question
Chapter 20.1, Problem 1CC
Summary Introduction
To determine: The bonds cleaved when restriction enzyme PvuI cuts its specific site in the DNA sequence.
Concept introduction:
Restriction enzymes recognize their specific target sequence and excise DNA at that sequence or adjacent to it. These specific sequences are known as restriction sites and the enzymes are known as DNA cutting enzymes. These make staggered cuts at or adjacent to their specific recognition site and most of them produce sticky ends.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
MAKE CONNECTIONS Although the proteins that cause theE. coli chromosome to coil are not histones, what propertywould you expect them to share with histones, given theirability to bind to DNA (see Figure 5.14)?
8. Altering Linking Number (a) What is the Lk of a 5,000 op circular duplex DNA molecule with a nick in one strand? (b) What is the Lk of the molecule in (a) when the nick is sealed (relaxed)? (c) How would the Lk of the molecule in (b) be affected by the action of a single molecule of E. coli topoi somerase 12 (d) What is the Lk of the molecule in (b) after eight enzymatic turnovers by a single molecule of DNA gyrase in the presence of ATP? (e) What is the Lk of the molecule in (d) after four enzymatic turnovers by a single molecule of bac terial type I topoisomerase? (1) What is the Lk of the molecule in (d) after binding of one nucleosome core?
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:
a)requires all four ribonucleoside triphosphates and a DNA template.
b)can extend an RNA chain and initiate a new chain.
c)recognizes specific start signals in DNA.
d)produces an RNA polymer that begins with a 5'-triphosphate.
e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Chapter 20 Solutions
CAMPBELL BIO TXT+MOD.MAST.BIO W ETEXT
Ch. 20.1 - Prob. 1CCCh. 20.1 - Prob. 2CCCh. 20.1 - What are some potential difficulties in using...Ch. 20.1 - Prob. 4CCCh. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - Prob. 5TYUCh. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 9TYUCh. 20 - Prob. 10TYUCh. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 12TYUCh. 20 - Prob. 13TYUCh. 20 - The water in the Yellowstone National Park hot...
Knowledge Booster
Similar questions
- WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?arrow_forward5. The Cy3 and Cy5 molecules were used in a FRET experiment. (e) Describe how the appearance of the donor and acceptor fluorescence spectrum will be different for the 12 base pair (bp) construct and the 21 base pair (bp) construct. Draw a spectrum for each.arrow_forwardNeed help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?arrow_forward
- 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched by a tRNA anticodon that is its perfect complement), how many tRNAs would be required to service all of the threonine codons?arrow_forward1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2. Instead of the term “Formation of a nucleoside”, what could the name of the reaction be? What functional group is being formed? Briefly Explain.arrow_forwardVISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forward
- A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)arrow_forwardA scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?arrow_forwardRecombination in Immunoglobulin Genes If recombination between a Vkand Jkgene formed a CCA codon at codon 95 (Figure 28.41), which amino acid would appear at this position?arrow_forward
- 52Protein synthesis takes place on ( ). 53The eukaryotic pathway of polypeptide chain elongation is the same as the bacterial pathway except that eEF1A and eEF2 replace eF1A and EF2. Yesorno 54Which experiment show that σ70-RNA polymerase combines with promoter DNA to form a closed and an open complex?A.Footprintingb.Southern blottingc.ComplementationD.DNase protectionarrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardBased on the data shown where is the DNA binding domain? Explain which constructs helped you reach this conclusion? Which part of the protein is the Activation domain? Explain which constructs helped you reach your conclusion?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning