GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 30EQ
An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the experiment shown here, an EMSA was used to examine the requirements for the binding of RNA polymerase II (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (Figure 12.14). In this experiment, the segment of DNA containing a promoter sequence was 1100 bp in length. The fragment was mixed with various combinations of proteins and then subjected to an EMSA.
Explain which proteins (TFIID, TFIIB, or RNA polymerase II) are able to bind to this DNA fragment by themselves. Which transcription factors (i.e., TFIID or TFIIB) are needed for the binding of RNA polymerase II?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
An electrophoretic mobility shift assay can be used to study the bindingof proteins to a segment of DNA. In the results shown here, anelectrophoretic mobility shift assay was used to examine the requirementsfor the binding of RNA polymerase II (from eukaryotic cells)to the promoter of a protein-encoding gene. The assembly of generaltranscription factors and RNA polymerase II at the core promoteris described in Chapter 14 (Figure 14.14). In this experiment, thesegment of DNA containing a promoter sequence was 1100 bpin length. The fragment was mixed with various combinations ofproteinsand then subjected to an electrophoretic mobility shift assay.Explain which proteins (TFIID, TFIIB, or RNA polymerase II) areable to bind to this DNA fragment by themselves. Which transcriptionfactors (i.e., TFIID or TFIIB) are needed for the binding ofRNA polymerase II?
Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.
You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience.
From this experiment you can conclude that:
Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon).
True or false:
Spacer
(a)
-10 region
-35 region
TTGACA
Consensus sequence
TATAAT
Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT
Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT
Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT
Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
(b)
700
600-
500-
400-
300-
200-
100.
0
● True
O False
B-Galactosidase activity
Wild-type…
Chapter 21 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- SR proteins are essential to proper spliceosome assembly and are known to take part in the regulation of alternative splicing. Surprisingly, the role of SR proteins in splice-site selection and alternative splicing is affected by the promoter used for the transcription of the pre-mRNA. For example, through genetic engineering, RNA polymerase II promoters that have somewhat different sequences can be created. When pre-mRNAs with exactly the same sequences are transcribed from two different RNA polymerase II promoters that differ slightly in sequence, which promoter is used can affect how the pre-mRNA is spliced. Propose a mechanism by which the DNA sequence of an RNA polymerase II promoter could affect alternative splicing of pre-mRNA.arrow_forwardGal4 is a transcription factor that activates transcription of galactose metabolism genes in yeast. These genes are ‘turned on’ when yeast cells need to metabolize galactose. To identify promoter sequences necessary for regulation of transcription of GAL1, reporter gene fusions were made and introduced into yeast cells. Deletions of GAL1 promoter were cloned upstream of LacZ gene. β-Galactosidase activity was measured in presence of galactose. Shown below is a representation of the results obtained. In the diagrams below (not to scale!): • Construct 1 contains ~ 130bp of the promoter, which is predicted to have all the predicted/putative proximal promoter elements (indicated by the solid boxes) needed to regulate transcription of GAL1.• The stippled box is the core promoter.• The arrow represents the transcriptional start site for the reporter gene Lac Z• Number of + signs represents level of transcription• Star represents a mutation in DNA sequence at that location (few nucleotides…arrow_forwardRNA knockdown has become a powerful tool in the arsenal of methods used to repress gene expression. Briefly describe how gene expression can be knocked down. What effect would introducing siRNAs to TSC1 have on human cells?arrow_forward
- Here is the model for TfR mRNA regulation (see Fig.), for your convenience. Orange protein (IRP or IREBP), when bound to RNA, protects mRNA from degradation. When Fe is bound to the protein, it cannot bind the mRNA. If you made a radioactive DNA probe specific to TfR mRNA and performed a Northern blot analysis (to detect mRNA) from cells treated with high iron (Fe) concentration what would you expect to see? (a) Low iron RNase A (b) High iron O High levels of RNase O Low levels of TfR mRNA Fe RNase O The result would be the same as untreated cells Degradation O High levels of IRP (or IREBP - iron responsive element binding protein) O High levels of TfR mRNAarrow_forwardWhich serine in the CTD of RNA polymerase II is phosphorylated to recruit enzymes to add the 5’ guanosine cap? How is this phosphorylation different than the CTD phosphorylation in promoter clearance?arrow_forwardExplain how a transcriptional fusion to a reporter gene, combined with site directed mutagenesis, can indicate key nucleotides in a regulatory region. Name one in vitro technique that can be used to further confirm the significance of these regions.arrow_forward
- Suppose you had isolated a new transcription factor and wanted to know which genes this protein might regulate. Is there any way that you could use a cDNA microarray of the type shown in the picture to approach this question?arrow_forwardThe following diagram show what is required for an active promoter of a gene of interest, where:A1 = Activator 1A2 = Activator 2Med = MediatorRep = Repressor Based on the following data, predict: Chromatin conformation Methylation state of the proximal promoter If protein A1 is present or absent If protein A2 is present or absent If the mediator is present or absent If the repressor is absence or present If this gene is likely to be transcribed or notPlease note that this is an "all or nothing" bonus question, and no partial credit will be awarded. Selecting all answers will result in zero points awarded. Selecting at least one incorrect answer will result in zero points being awarded. Question 28 options: Euchromatin Heterochromatin Methylated promoter Unmethylated promoter Activator A1 present Activator A1 absent Activator A2 present…arrow_forwardWhich of the following statements is true regarding the lys2-128d reporter? Select all that apply. a.) Mutants that activate this reporter are likely to have mutations in PIC components. b.) This reporter is sensitive to changes in chromatin maintenance because the start site is located within the ORF. c.) Mutants that activate this reporter cause downstream shifts in transcription start site selection. d.) This reporter is being used to help us rule out mutations that are likely impacting chromatin structure.arrow_forward
- The IMD2 promoter contains three upstream transcription start sites (TSS) that are utilized under high GTP conditions and a single downstream TSS (-106) that is normally only utilized under low GTP conditions. In a wild type cell, expression of IMD2 mRNA only occurs if transcription initiates from the -106 TSS. In 300 words or less, describe: 1.) The normal function of Ssl2, and 2.) why a mutation in Ssl2, that increases its catalytic rate, would allow expression of the IMD2 ORF under high GTP conditions. (Conditions under which the IMD2 ORF is NOT expressed in the wild type.)arrow_forwardBacterial DNA containing an operon encoding three enzymes is introduced into chromosomal DNA in yeast (a eukaryote) in such a way that it is properly flanked by a promoter and a transcriptional terminator. The bacterial DNA is transcribed and the RNA correctly processed, but only the protein nearest the promoter is produced. Can you suggest why?arrow_forwardIf the binding activity was purified, suggest two experimental approaches that could be taken to verify that this factor is in fact a transcription factor? Explain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY