GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21, Problem 32EQ
Summary Introduction
To analyze:
The region of DNA (deoxyribonucleic acid) which is bound by RNA (ribonucleic acid) polymerase II, TFIID (transcription factor), and TFIIB.
Introduction:
The DNA (deoxyribonucleic acid)-protein interaction can be studied and detected by the DNase I footprinting technique. The principle of this technique is that the regions which are bound by the enzyme or protein do not get cleaved or digested by the DNase enzyme. Thus, the fragments in the gel gets missing.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Transcription is thus the final stage of gene expression involves interactions between three types of RNA molecules (mRNA templates, tRNAs, and rRNAs).
Xeroderma Pigmentosum is a premature aging disease that begins in adolescence or early adulthood and results in the appearance of old age by 30-40 years of age.
In the lagging strand, the enzyme X removes RNA primers attached by Primase and this gap is then filled in by DNA Polymerase I. The enzyme X is topoisomerase.
The ribosomes of prokaryotes are usually found in the rough ER and cytoplasm.
Write T if the statement is true and write F if the statement is false
How do you think that transcription randomizes positions of nucleosomes and repression restores the ordering after transcription?
How might you test to see if there was an exchange of histone subunits during transcription or if the nucleosome is truly transferred as a single unit?
Would you expect the DNA band representing the distance from the restriction enzyme site to the hypersensitive site to be a single band or a smear? Defend your answer.
Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.
Chapter 21 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Different sensitivities to the mushroom toxin a-amanitin distinguish the three RNA polymerases from one another. Which of the following properties listed below also distinguish RNA Polymerase II from Pol I and Pol III? Options: Only RNA Pol II possesses a large subunit RNA Polymerase I and RNA Polymerase III do not require TBP for optimal transcription efficiency only RNA Polymerase II requires an ATP-dependent helicase to melt the DNA around the transcription start site Only RNA Polymerase II resembles the prokaryotic RNA Polymerase RNA Pol II has an extended N terminal region that becomes phosphorylated during intiationarrow_forwardYou’re going for a bike ride, and as your muscles work harder, your body needs to produce more of the enzyme. You now know genes are transcribed from DNA into RNA in the nucleus and translated from RNA into proteins by ribosomes. Explain the steps of its creation from DNA to protein. Aside for having a nasty inhibitor around like the one from that insecticide, how else might an enzyme end up being non-functioning? During transcription, a base substitution occurred. Explain two reasons why this change in nucleotide sequence could result in no change to the protein.arrow_forwardThis is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1) 1)Which strand is the template strand for transcription? a)top b) bottom 2)What elements allowed you to identify the template strand? (Select all that apply) a)An ATG toward the 5' end ("upstream"} from the TSS b)The template strand has the 3' end on the left side. c) An ATG toward the 3' ("downstream") from the TSS d) The template strand is "read" by the polymerase from its 3' to 5' end. 3)What is the sequence of the mRNA transcribed from this gene? a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’ b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’ c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’ d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’ 4) Write the…arrow_forward
- The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.arrow_forwardSince RNA polymerase has an error rate of 1 / 10^4 nucleotides, and the DNA polymerase has an error rate of 1 / 10^7 nucleotides, can cells tolerate errors made in transcription in comparison to errors made during DNA replication?arrow_forwardSuppose you want to study the transcription in vitro of one particular gene in a DNA molecule that contains several genes and promoters. Without adding specific regulatory proteins, how might you stimulate transcription from the gene of interest relative to the transcription of the other genes on your DNA template? To make all of the complexes identical, you would like to arrest all transcriptional events at the same position on the DNA template before isolating the complex. How might you do this?arrow_forward
- Suppose you had isolated a new transcription factor and wanted to know which genes this protein might regulate. Is there any way that you could use a cDNA microarray of the type shown in the picture to approach this question?arrow_forwardTransfer RNA in eukaryotic cells is synthesized by which of the following enzymes (sensitive to high concentrations of the fungal poison a-amanitin, but not to low concentrations)? RNA polymerase I DNA polymerase I RNA polymerase II DNA polymerase II RNA polymerase III Which of the following processes of genetic information flow can occur under laboratory conditions, but has never been observed to occur under natural conditions (either in living cells or in viruses)? transcription of RNA from a DNA template (using DNA-dependent-RNA-polymerase) self-replication of RNA from an RNA template (using RNA-dependent-RNA-polymerase) direct-translation of protein from a DNA template (using special ribosomes) self-replication of DNA from a DNA template (using DNA-dependent-DNA-polymerase) translation of protein from an RNA template (using ordinary ribosomes)arrow_forwardThis diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the transcription start site. The direction of transcription is also indicated. In which box would you find a 5’TATAA \3’ promoter sequence that would be used for initiating transcription at the start site shown? a) Box A b) Box B c) Box C d) Box Darrow_forward
- Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?arrow_forwardConsider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.arrow_forwardSuppose you have a 1-kb segment of cloned DNA that is suspected to contain a eukaryotic promoter including a TATA box, a CAT box, and an upstream GC-rich sequence. The clone also contains a gene whose transcript is readily detectable. Your laboratory supervisor asks you to outline an experiment. (1) determine if eukaryotic transcription factors (TF) bind to the fragment and, if so, (2) identify where on the fragment the transcription factors bind. All necessary reagents, equipment, and experimental know-how are available in the laboratory. Complete the outline of an experiment, which determines if eukaryotic transcription factors (TF) bind to the fragment. Assume all necessary reagents, equipment, and experimental how are available in the laboratory. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. For the band shift assay, two samples of the DNA fragment are analyzed by agarose gel electrophoresis: one sample is…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY