Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 21.2, Problem 3CC
MAKE CONNECTIONS Ø The ENCODE pilot project found that at least 75% of the genome is transcribed into RNAs, far more than could be accounted for by proteiri-coding genes. Review Concepts 17.3 and 18.3 and suggest some roles that these RNAs might play.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Q1 There are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ.
b) Hypothesize the transcription of eukaryotic genes using prokaryotic promoter with further explanation.
In a few sentences:
Describe in detail the 3 steps of transcription and the 3 steps of translation.
• Describe what types of post-transcription modifications occur in eukaryotic cells.
Describe how proteins may be processed after translation
●
●
For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac).
BIUS
Paragraph
V Arial
X² X₂¶¶<
view....pdf
PDF
WOUL
19
Pam
+₁
ABC
V 10pt
V ✓ ¶ "Q
WHAT IF? What would be the effect of treating cellswith an agent that removed the cap from mRNAs?
Chapter 21 Solutions
Campbell Biology: Custom Edition
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - MAKE CONNECTIONS The ENCODE pilot project found...Ch. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Additional Science Textbook Solutions
Find more solutions based on key concepts
1. The correct sequence of levels forming the structural hierarchy is
A. (a) organ, organ system, cellular, che...
Human Anatomy & Physiology (Marieb, Human Anatomy & Physiology) Standalone Book
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
The pedigrees indicated here were obtained with three unrelated families whose members express the same disease...
Genetics: From Genes to Genomes
Relative thickness of the myocardium in different chambers; the functional significance of those differences; a...
Anatomy & Physiology: The Unity of Form and Function
What were the major microbiological interests of Martinus Beijerinck and Sergei Winogradsky? It can be said tha...
Brock Biology of Microorganisms (14th Edition)
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Q.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples? B.)aminoacyl tRNA synthetase is specialized or not ? And why?arrow_forwardMAKE CONNECTIONS Compare the CRISPR-Cas systemto the miRNA system discussed in Concept 18.3, includingtheir mechanisms and their functions.arrow_forward5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’sarrow_forward
- Expression of a cloned eukaryotic gene in a bacterial cellinvolves many challenges. The use of mRNA and reversetranscriptase is part of a strategy to solve the problem of(A) post-transcriptional processing.(B) post-translational processing.(C) nucleic acid hybridization.(D) restriction fragment ligationarrow_forwardE30. An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the experiment shown here, an EMSA was used to examine the requirements for the bind- ing of RNA polymerase II (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (Figure 12.14). In this experiment, the segment of DNA containing a promoter sequence was 1100 bp in length. The fragment was mixed with various combinations of proteins and then subjected to an EMSA. Lane 1: No proteins added Lane 2: TFID Lane 3: TFIIB Lane 4: RNA polymerase I| Lane 5: TFID + TFIIB Lane 6: TFID + RNA 1 2 4 5 6 polymerase II| Lane 7: TFIID + TFIIB + RNA polymerase I| 1100 bp Explain which proteins (TFIID, TFIIB, or RNA polymerase II) are able to bind to this DNA fragment by themselves. Which transcrip- tion factors (i.e., TFIID or TFIIB) are needed for the binding of…arrow_forwardMAKE CONNECTIONS The restriction site for an enzymecalled PvuI is the following sequence:5’-CGATCG-3’3’-GCTAGC-5’arrow_forward
- 97Which of the following is examples of a transposable element found in bacteria? (multiple choice questions)A.IS903b.Tn5c.IS1D.Xis 98What is the key component of the catalytic site of the spliceosome? (multiple choice questions)A.DNAb.ribosomesc.proteinD.RNA 99Which antibiotic can binds to RNA polymerase and blocks an early step in RNA synthesis?A.Ampicillinb.Chloramphenicolc.RimantidineD.None of the above 100All tRNA molecules have poly (A) tails at their 3' end. Yesornoarrow_forwardExamine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5' CACUGAUGCACGGAUGAU 3' What is the THIRD amino acid that will be translated in the wild-type sequence? SECOND BASE G. C. uGu-Cystelne (Cys) Uac UGA -Stop codon UGa -Tryptophan (Trp) UCU Ucc UAU UAC Tyrosine (Tyr) Phenylalanine (Phe) UUC. Serine (Ser) U UUA UuG UAA -Stop codon UAG -Stop codon UCA Leucine (Leu) Uca. CGu cac ccu CUU CUC CAU Histidine (His) Leucine (Leu) Proline (Pro) CAC Arginine (Arg) CUA CaA CCA ccG CAA Cua Glutamine (Gin) caa CAG ACU ACC AGU AUU AUC AAU Asparagine (Asn) Serine (Ser) Isoleucine (le) AAC AGC Threonine (Thr) AUA ACA AAA AGA Methionine (Met) Start codon ACC AAG -Lysine (Lyn) AGG Arginine (Arg) AUG - GcU GAU GUU GUC GUA GUG Aspartic acid (Asp) GAC GcC GCA aco Valine (Val) Alanine (Ala) -Glycine (Gly) GGA GAA GAG Glutamic acid (Glu) O Cysteine O Methionine O Histidine O Glycine FIRST BASE THIRD BASEarrow_forwardE17. Gene mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid sequence affect the function of a protein. Let's suppose that you are interested in the functional importance of a particular glutamic acid (an amino acid) within a protein you are studying. By site-directed mutagenesis, you make mutant proteins in which this glutamic acid codon has been changed to other codons. You then test the encoded mutant proteins for functionality. The results are as follows: Functionality (%) Normal protein 100 Mutant proteins containing Тугosine Phenylalanine 3 Aspartic acid 94 Glycine From these results, what would you conclude about the functional significance of this glutamic acid within the protein?arrow_forward
- WHAT IF? In eukaryotic cells, mRNAs have been foundto have a circular arrangement in which proteins holdthe poly-A tail near the 5¿ cap. How might this increasetranslation efficiency?arrow_forward. In many bacterial species, regulatory sRNAs havebeen identified by transcriptome sequencing (RNASeq). How do researchers know that the small RNAspecies identified by cDNA sequencing are regulatorysRNAs rather than fragments of longer mRNAs?arrow_forwardExamine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5' CACUGAUGCACGGAUGAU 3' What kind of mutation is occurring in the mutant sequence compared to the wild type sequence? SECOND BASE Phenylalanine (Phe) UCU UAU Tyrosine (Tyr) UGU Cysteine (Cys) UUC UCc UAC UGC Serine (Ser) UAA -Stop codon UAG -Stop codon UGA -Stop codon uGa -Tryptophan (Trp) UUA UCA Leucine (Leu) UUG uca CUU CCU Cuc CAU CAC Histidine (His) CGU Leucine (Leu) Proline (Pro) C. CUA CuG Dainine (Arg) CCA cca CGA CAA CAG Glutamine (GIin) cGG AUU AUC ACU ACC ACA AAU AGU Isoleucine (lle) AAC Asparagine (Asn) AGC Serine (Ser) Threonine (Thr) AUA AAA Methionine (Met) Sta AGA AGG ACG AAG FLysine (Lys) Arginine (Arg) AUG - codon GUU Gcu Gcc GCA GAU GGU GUC GAc Aspartic acid (Asp) G. GUA Valine (Val) Alanine (Ala) Glycine (Gly) GAA GAG Glutamic acid (Glu) GGA GaG GUG aca O Silent O Missense O Nonsense O Frameshift FIRST BASE THIRD BASEarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY