Concept explainers
MAKE CONNECTIONS Ø Assign each DNA segment at the top of Figure 18.8 to a sector in the pie chart in Figure 21.6.
Ú Figure 18.8 A eukaryotic gene and its transcript. Each eukaryotic gene has (distal to) the promoter. Distal control elements can be grouped together as enhancers, one of
Ú Figure 21.6 Types of DNA sequences in the human genome.
The gene sequences that code for proteins or are transcribed into rRNA or tRNA molecules make up only about 1.5% of the human genome (dark purple in the pie chart). while introns and regulatory sequences associated with genes (light purple) make up about a quarter. The vast majority of the human genome does not code for proteins (although much of it gives rise to RNAs), and a large amount is repetitive DNA (dark and light green and teal).
Want to see the full answer?
Check out a sample textbook solutionChapter 21 Solutions
Campbell Biology: Custom Edition
Additional Science Textbook Solutions
MARINE BIOLOGY
Campbell Essential Biology (7th Edition)
Human Physiology
Prescott's Microbiology
Anatomy & Physiology
Human Anatomy & Physiology (2nd Edition)
- The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madearrow_forwardGiven the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardA scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.arrow_forward
- The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.arrow_forwardBelow is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'arrow_forward"Upstream" "Downstream" Exons Start of transcription Termination codon 5 3' Promoter initiator codon Introns Polyadenylation signal (intervening sequences) 5' untranslated region 3' untranslated region Direction of transcription Please study the diagram above on eukaryotic gene expression. In order to provide instructions for gene expression, a eukaryotic gene should have the following sequences except for O A. Promoter B. Start codon also known as initiator codon C. Splicing signals (dinucleotide sequence in the intron) O D. 5' CAP sequencearrow_forward
- SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/Aarrow_forwardPlease match the gene element with the the correct definition. control elements 5' UTR 3' UTR Promoter coding region +1 site [Choose ] stretch of DNA that contains the sequence that will encode the protein the active form of RNA polymerase region of DNA upstream of transcription start site that is recognized by RNA polymerase region of mRNA on the 5' end that goes untranslated RNA polymerase and the sigma factor regions of DNA that increase or decrease transcription rate the first nucleotide to be transcribed region of mRNA on the 3' end that goes untranslated a transcription initiation factor that helps RNA polymerase recognize the promoter the inactive form of RNA polymerase [Choose ] [Choose ]arrow_forward. Eukaryotic processing of hnRNA into mature mRNA includes all of the following steps except: ribosome attachment of methionine to the 5’-AUG-3’ codon 5’-addition of a 7-methylguanosine cap 3’-addition of a polyadenylated tail splicing together of exons excision of intronsarrow_forward
- c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…arrow_forwardFrom the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene THERE are multiple answer for this that I can choose Group of answer choices A 3' UTR B PPE sequences C 5' UTR D introns E core promoter F coding sequence G DNA-bending protein H enhancer sequence I mediator proteinarrow_forwardThe base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning