EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
7th Edition
ISBN: 8220100853180
Author: STOKER
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 22, Problem 22.59EP
In the replication of a DNA molecule, two daughter molecules, Q and R, are formed. The following base sequence is part of the newly formed strand in daughter molecule Q.
Indicate the corresponding base sequence in
- a. the newly formed strand in daughter molecule R.
- b. the “parent” strand in daughter molecule Q.
- c. the “parent” strand in daughter molecule R.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand
3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand
a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand.
c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence,
d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates?
3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5'
What type of mutation is this?
Which of the following statements about RNA is/are incorrect?
I. RNA strand synthesis does not occur during replication.
II. All RNA strands produced during transcription are translated into proteins.
III. RNA strands are composed of 10 nucleotide bases per turn.
IV. RNA strands can pair with a DNA strand.
V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand
O I, II, and IV
O I, II, III, IV, and V
O II, IV and V
O II, IV and V
OI, II, III and V
O Il and III
What is true of this figure? (can be multiple answers)
a. the replication fork is asymmetrical
b. the DNA strands are anti-parallel
c. one strand runs 3’ to 5’
d. one strand runs 5’ to 3’
e. both strands have identical bases
Chapter 22 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
Ch. 22.1 - Which of the following statements concerning...Ch. 22.1 - Which of the following statements concerning...Ch. 22.2 - Any given nucleotide in a nucleic acid contains a....Ch. 22.2 - How many different sugars and how many different...Ch. 22.2 - How many different heterocyclic bases that are...Ch. 22.3 - Which of the following is present in nucleotides...Ch. 22.3 - Which of the following is an incorrect statement...Ch. 22.3 - How many of the eight nucleic acid nucleotides are...Ch. 22.3 - Prob. 4QQCh. 22.4 - Prob. 1QQ
Ch. 22.4 - The backbone of a nucleic acid molecule involves...Ch. 22.4 - In a segment of a nucleic acid each nonterminal...Ch. 22.4 - Prob. 4QQCh. 22.4 - Prob. 5QQCh. 22.5 - Prob. 1QQCh. 22.5 - Prob. 2QQCh. 22.5 - Fifteen percent of the bases in a certain DNA...Ch. 22.5 - Which of the following is the correct...Ch. 22.6 - Replication of DNA produces two daughter molecules...Ch. 22.6 - In DNA replication the DNA double helix unwinds...Ch. 22.6 - Prob. 3QQCh. 22.6 - In DNA replication the unwinding of the DNA double...Ch. 22.6 - Prob. 5QQCh. 22.7 - Prob. 1QQCh. 22.7 - Prob. 2QQCh. 22.8 - Prob. 1QQCh. 22.8 - The m in the designation mRNA stands for a. mega...Ch. 22.8 - Prob. 3QQCh. 22.8 - Prob. 4QQCh. 22.9 - Prob. 1QQCh. 22.9 - Prob. 2QQCh. 22.9 - Prob. 3QQCh. 22.9 - Prob. 4QQCh. 22.9 - Prob. 5QQCh. 22.10 - Which of the following statements concerning...Ch. 22.10 - Prob. 2QQCh. 22.10 - Prob. 3QQCh. 22.10 - Prob. 4QQCh. 22.11 - Which of the following is an incorrect pairing of...Ch. 22.11 - Prob. 2QQCh. 22.11 - A tRNA molecule with the anticodon 5 AAG 3 will...Ch. 22.12 - Prob. 1QQCh. 22.12 - Which of the following events is not part of the...Ch. 22.12 - The number of codon binding sites in an...Ch. 22.12 - Prob. 4QQCh. 22.12 - Prob. 5QQCh. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following statements applies to both...Ch. 22.14 - Which of the following statements about a virus is...Ch. 22.14 - Prob. 2QQCh. 22.15 - Prob. 1QQCh. 22.15 - Prob. 2QQCh. 22.15 - The role of E. coli plasmids in obtaining rDNA is...Ch. 22.15 - Prob. 4QQCh. 22.15 - Prob. 5QQCh. 22.16 - Prob. 1QQCh. 22.16 - Each cycle of the polymerase chain reaction a....Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following pentoses is...Ch. 22 - Indicate whether each of the pentoses in Problem...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - How many different choices are there for each of...Ch. 22 - How many different choices are there for each of...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following is a DNA...Ch. 22 - Prob. 22.20EPCh. 22 - Nucleotides containing ribose, thymine, and...Ch. 22 - Prob. 22.22EPCh. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - For the trinucleotide 5 GCA 3 a. How many...Ch. 22 - For the trinucleotide 5 UCG 3 a. How many...Ch. 22 - Is the trinucleotide in Problem 22-31 found only...Ch. 22 - Is the trinucleotide in Problem 22-32 found only...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - Draw the structure of the RNA dinucleotide 5 UG 3.Ch. 22 - Draw the structure of the DNA dinucleotide 5 TA 3.Ch. 22 - For the trinucleotide 5 T-G-A 3 a. How many...Ch. 22 - For the trinucleotide 5 U-C-G 3 a. How many...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following are...Ch. 22 - Indicate whether each of the following are...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - What structural consideration prevents the bases A...Ch. 22 - What structural consideration prevents the bases C...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - For the DNA segment 5 TTGCAC 3 how many of each of...Ch. 22 - For the DNA segment 5 TAGATG 3 how many of each of...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - How does the synthesis of a daughter DNA strand...Ch. 22 - Prob. 22.62EPCh. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.65EPCh. 22 - Prob. 22.66EPCh. 22 - Suppose that 28% of the nucleotides in a DNA...Ch. 22 - Suppose that 30% of the nucleotides in a DNA...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.70EPCh. 22 - Prob. 22.71EPCh. 22 - Prob. 22.72EPCh. 22 - Prob. 22.73EPCh. 22 - Prob. 22.74EPCh. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether each of the following situations...Ch. 22 - Indicate whether each of the following processes...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.81EPCh. 22 - Prob. 22.82EPCh. 22 - For each of the following DNA template strands,...Ch. 22 - Prob. 22.84EPCh. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.86EPCh. 22 - Prob. 22.87EPCh. 22 - Prob. 22.88EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.90EPCh. 22 - Prob. 22.91EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.93EPCh. 22 - Prob. 22.94EPCh. 22 - Prob. 22.95EPCh. 22 - An hnRNA molecule contains three exons, with the...Ch. 22 - Prob. 22.97EPCh. 22 - Indicate whether each of the following...Ch. 22 - Prob. 22.99EPCh. 22 - Prob. 22.100EPCh. 22 - Prob. 22.101EPCh. 22 - Prob. 22.102EPCh. 22 - Prob. 22.103EPCh. 22 - Prob. 22.104EPCh. 22 - Explain why the base sequence ATC could not be a...Ch. 22 - Explain why the base sequence AGAC could not be a...Ch. 22 - Predict the sequence of amino acids coded by the...Ch. 22 - Prob. 22.108EPCh. 22 - Prob. 22.109EPCh. 22 - Prob. 22.110EPCh. 22 - Determine each of the following items using the...Ch. 22 - Determine each of the following items using the...Ch. 22 - Prob. 22.113EPCh. 22 - Prob. 22.114EPCh. 22 - Prob. 22.115EPCh. 22 - Prob. 22.116EPCh. 22 - Prob. 22.117EPCh. 22 - Prob. 22.118EPCh. 22 - Prob. 22.119EPCh. 22 - Which amino acid will a tRNA molecule be carrying...Ch. 22 - Prob. 22.121EPCh. 22 - Prob. 22.122EPCh. 22 - Prob. 22.123EPCh. 22 - The following is a base sequence for an exon...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.126EPCh. 22 - Prob. 22.127EPCh. 22 - Prob. 22.128EPCh. 22 - Prob. 22.129EPCh. 22 - Prob. 22.130EPCh. 22 - Prob. 22.131EPCh. 22 - Prob. 22.132EPCh. 22 - Prob. 22.133EPCh. 22 - Prob. 22.134EPCh. 22 - Consider the following mRNA base sequence 5CUUCAG3...Ch. 22 - Consider the following mRNA base sequence 5ACCCAC3...Ch. 22 - Consider the following DNA base sequence 3TTAATA5...Ch. 22 - Consider the following DNA base sequence 3TATCGG5...Ch. 22 - The DNA template strand segment 3TTCAAACCGTAC5...Ch. 22 - Prob. 22.140EPCh. 22 - Prob. 22.141EPCh. 22 - Prob. 22.142EPCh. 22 - Prob. 22.143EPCh. 22 - Prob. 22.144EPCh. 22 - Prob. 22.145EPCh. 22 - Prob. 22.146EPCh. 22 - Prob. 22.147EPCh. 22 - Prob. 22.148EPCh. 22 - Prob. 22.149EPCh. 22 - Prob. 22.150EPCh. 22 - Prob. 22.151EPCh. 22 - Prob. 22.152EPCh. 22 - Prob. 22.153EPCh. 22 - Prob. 22.154EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityarrow_forwardLook at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forward1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.arrow_forward
- The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forwardWhich statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.arrow_forwardIdentify the sites of lagging strand synthesis. Select all that are true. B A 5 O a. C O b. D O c. A O d. Barrow_forward
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardWhich of the following statements are true regarding the properties of DNA and RNA polymerase. Select all that apply. Both DNA and RNA polymerase synthesize nucleic acid strands in the 5" to 3' direction. Both DNA and RNA polymerase can initiate strand synthesis on their own. I. RNA polymerase initiates strand synthesis, while DNA polymerase depends upon an existing strand to continue synthesis. II. RNA polymerase only uses ribonucleotides for strand synthesis. DNA polymerase only uses deoxyribonucleotides for strand synthesis. V. Au DNA and RNA polymerases from eukaryotes behave very differently from DNA and RNA polymerases found in prokaryotes. O VI.arrow_forwardWhich of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.arrow_forward
- a. unwinds the DNA helix b. stabilizes and stops the two strands from annealing (rebinding with each other) c. recoils the DNA d. cleaves both strands of DNA to relieve tension at supercoils e. places RNA primers at their proper location on the template strands f. acts as starting points for DNA polymerase g. adds DNA nucleotides to form new DNA strands h. forms phosphodiester bonds to join Okazaki fragments Esc 1. single-strand binding protein 2. helicase 3. DNA ligase 4. RNA primer 5. gyrase 6. DNA polymerase 53°F Cloudy 3 Q Search $ F5 FRarrow_forwardIn one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of DNA polymerase III =arrow_forwardWhich of the following is NOT TRUE about replication? A. Polynucleotides are made up of deoxynucleotide monophosphates but the substrates are deoxynucleotide triphosphates B. The mechanism of the reaction is nucleophilic addition C. In the formation of primers, nucleotides are added in any direction D. Both nucleotide triphosphates and deoxynucleotide triphosphates are substrates in replication E. Direction of synthesis is 5'23' and lengthens unidirectionally relative to the double strand.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Nucleic acids - DNA and RNA structure; Author: MEDSimplified;https://www.youtube.com/watch?v=0lZRAShqft0;License: Standard YouTube License, CC-BY