![EBK GENERAL, ORGANIC, AND BIOLOGICAL CH](https://www.bartleby.com/isbn_cover_images/8220100853180/8220100853180_largeCoverImage.jpg)
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
7th Edition
ISBN: 8220100853180
Author: STOKER
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 22, Problem 22.85EP
What is the base sequence, specified in the 5′-to-3′ direction, for the DNA strand from which each of the following hnRNA base sequences was transcribed?
- a. 5′ CCUUAA 3′
- b. 5′ ACGUAC 3′
- c. 5′ ACGACG 3′
- d. 5′ UACCAU 3′
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
Answer the following whether it is TRUE or FALSE:
1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3'
2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'.
3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'.
4. The template strand is the strand of DNA used for RNA synthesis.
5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
Chapter 22 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
Ch. 22.1 - Which of the following statements concerning...Ch. 22.1 - Which of the following statements concerning...Ch. 22.2 - Any given nucleotide in a nucleic acid contains a....Ch. 22.2 - How many different sugars and how many different...Ch. 22.2 - How many different heterocyclic bases that are...Ch. 22.3 - Which of the following is present in nucleotides...Ch. 22.3 - Which of the following is an incorrect statement...Ch. 22.3 - How many of the eight nucleic acid nucleotides are...Ch. 22.3 - Prob. 4QQCh. 22.4 - Prob. 1QQ
Ch. 22.4 - The backbone of a nucleic acid molecule involves...Ch. 22.4 - In a segment of a nucleic acid each nonterminal...Ch. 22.4 - Prob. 4QQCh. 22.4 - Prob. 5QQCh. 22.5 - Prob. 1QQCh. 22.5 - Prob. 2QQCh. 22.5 - Fifteen percent of the bases in a certain DNA...Ch. 22.5 - Which of the following is the correct...Ch. 22.6 - Replication of DNA produces two daughter molecules...Ch. 22.6 - In DNA replication the DNA double helix unwinds...Ch. 22.6 - Prob. 3QQCh. 22.6 - In DNA replication the unwinding of the DNA double...Ch. 22.6 - Prob. 5QQCh. 22.7 - Prob. 1QQCh. 22.7 - Prob. 2QQCh. 22.8 - Prob. 1QQCh. 22.8 - The m in the designation mRNA stands for a. mega...Ch. 22.8 - Prob. 3QQCh. 22.8 - Prob. 4QQCh. 22.9 - Prob. 1QQCh. 22.9 - Prob. 2QQCh. 22.9 - Prob. 3QQCh. 22.9 - Prob. 4QQCh. 22.9 - Prob. 5QQCh. 22.10 - Which of the following statements concerning...Ch. 22.10 - Prob. 2QQCh. 22.10 - Prob. 3QQCh. 22.10 - Prob. 4QQCh. 22.11 - Which of the following is an incorrect pairing of...Ch. 22.11 - Prob. 2QQCh. 22.11 - A tRNA molecule with the anticodon 5 AAG 3 will...Ch. 22.12 - Prob. 1QQCh. 22.12 - Which of the following events is not part of the...Ch. 22.12 - The number of codon binding sites in an...Ch. 22.12 - Prob. 4QQCh. 22.12 - Prob. 5QQCh. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following statements applies to both...Ch. 22.14 - Which of the following statements about a virus is...Ch. 22.14 - Prob. 2QQCh. 22.15 - Prob. 1QQCh. 22.15 - Prob. 2QQCh. 22.15 - The role of E. coli plasmids in obtaining rDNA is...Ch. 22.15 - Prob. 4QQCh. 22.15 - Prob. 5QQCh. 22.16 - Prob. 1QQCh. 22.16 - Each cycle of the polymerase chain reaction a....Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following pentoses is...Ch. 22 - Indicate whether each of the pentoses in Problem...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - How many different choices are there for each of...Ch. 22 - How many different choices are there for each of...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following is a DNA...Ch. 22 - Prob. 22.20EPCh. 22 - Nucleotides containing ribose, thymine, and...Ch. 22 - Prob. 22.22EPCh. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - For the trinucleotide 5 GCA 3 a. How many...Ch. 22 - For the trinucleotide 5 UCG 3 a. How many...Ch. 22 - Is the trinucleotide in Problem 22-31 found only...Ch. 22 - Is the trinucleotide in Problem 22-32 found only...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - Draw the structure of the RNA dinucleotide 5 UG 3.Ch. 22 - Draw the structure of the DNA dinucleotide 5 TA 3.Ch. 22 - For the trinucleotide 5 T-G-A 3 a. How many...Ch. 22 - For the trinucleotide 5 U-C-G 3 a. How many...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following are...Ch. 22 - Indicate whether each of the following are...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - What structural consideration prevents the bases A...Ch. 22 - What structural consideration prevents the bases C...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - For the DNA segment 5 TTGCAC 3 how many of each of...Ch. 22 - For the DNA segment 5 TAGATG 3 how many of each of...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - How does the synthesis of a daughter DNA strand...Ch. 22 - Prob. 22.62EPCh. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.65EPCh. 22 - Prob. 22.66EPCh. 22 - Suppose that 28% of the nucleotides in a DNA...Ch. 22 - Suppose that 30% of the nucleotides in a DNA...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.70EPCh. 22 - Prob. 22.71EPCh. 22 - Prob. 22.72EPCh. 22 - Prob. 22.73EPCh. 22 - Prob. 22.74EPCh. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether each of the following situations...Ch. 22 - Indicate whether each of the following processes...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.81EPCh. 22 - Prob. 22.82EPCh. 22 - For each of the following DNA template strands,...Ch. 22 - Prob. 22.84EPCh. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.86EPCh. 22 - Prob. 22.87EPCh. 22 - Prob. 22.88EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.90EPCh. 22 - Prob. 22.91EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.93EPCh. 22 - Prob. 22.94EPCh. 22 - Prob. 22.95EPCh. 22 - An hnRNA molecule contains three exons, with the...Ch. 22 - Prob. 22.97EPCh. 22 - Indicate whether each of the following...Ch. 22 - Prob. 22.99EPCh. 22 - Prob. 22.100EPCh. 22 - Prob. 22.101EPCh. 22 - Prob. 22.102EPCh. 22 - Prob. 22.103EPCh. 22 - Prob. 22.104EPCh. 22 - Explain why the base sequence ATC could not be a...Ch. 22 - Explain why the base sequence AGAC could not be a...Ch. 22 - Predict the sequence of amino acids coded by the...Ch. 22 - Prob. 22.108EPCh. 22 - Prob. 22.109EPCh. 22 - Prob. 22.110EPCh. 22 - Determine each of the following items using the...Ch. 22 - Determine each of the following items using the...Ch. 22 - Prob. 22.113EPCh. 22 - Prob. 22.114EPCh. 22 - Prob. 22.115EPCh. 22 - Prob. 22.116EPCh. 22 - Prob. 22.117EPCh. 22 - Prob. 22.118EPCh. 22 - Prob. 22.119EPCh. 22 - Which amino acid will a tRNA molecule be carrying...Ch. 22 - Prob. 22.121EPCh. 22 - Prob. 22.122EPCh. 22 - Prob. 22.123EPCh. 22 - The following is a base sequence for an exon...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.126EPCh. 22 - Prob. 22.127EPCh. 22 - Prob. 22.128EPCh. 22 - Prob. 22.129EPCh. 22 - Prob. 22.130EPCh. 22 - Prob. 22.131EPCh. 22 - Prob. 22.132EPCh. 22 - Prob. 22.133EPCh. 22 - Prob. 22.134EPCh. 22 - Consider the following mRNA base sequence 5CUUCAG3...Ch. 22 - Consider the following mRNA base sequence 5ACCCAC3...Ch. 22 - Consider the following DNA base sequence 3TTAATA5...Ch. 22 - Consider the following DNA base sequence 3TATCGG5...Ch. 22 - The DNA template strand segment 3TTCAAACCGTAC5...Ch. 22 - Prob. 22.140EPCh. 22 - Prob. 22.141EPCh. 22 - Prob. 22.142EPCh. 22 - Prob. 22.143EPCh. 22 - Prob. 22.144EPCh. 22 - Prob. 22.145EPCh. 22 - Prob. 22.146EPCh. 22 - Prob. 22.147EPCh. 22 - Prob. 22.148EPCh. 22 - Prob. 22.149EPCh. 22 - Prob. 22.150EPCh. 22 - Prob. 22.151EPCh. 22 - Prob. 22.152EPCh. 22 - Prob. 22.153EPCh. 22 - Prob. 22.154EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGAСTGACA. Briefly explain how to obtain the desired gene.arrow_forwardDefine the following terms: a. tiRNA b. monocistronic c. snRNPs d. antisense DNA strand e. sense DNA strandarrow_forwardThe sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forward
- Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′arrow_forwarddoes anyone know how to list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC.arrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forward
- In the following figure, provide RNA sequence of Gene a and Gene b in a 5'-3' direction. Provide the DNA sequence of Gene c on the non-template strand. 4. Genes a and c are transcribed from the bot strand,... RNA DNA 5' 3 Gene a GGACCTA Gene b Gene c 3' 5' ACGTCAG RNA RNA UUAGAUC ...and b is transcribed from the top strand.arrow_forwardDNA methyltransferases are important regulators of epigenetic marks/memory. What is the role of a DNA methyltransferase during DNA replication? A. They catalyze the addition of methyl groups to the new daughter strand using the parental strand's methylation pattern B. They remove all methyl tags from all of the DNA restoring the totipotent state prior to mitosis C. They catalyze the transfer of acetyl groups to certain nucleotides within the DNA after DNA replication has been completed D. They inhibit the methylation of the new daughter strand so that only one strand remains methylated after replicationarrow_forwardgive the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′arrow_forward
- The short Okazaki fragments are Select one: a. spliced together by DNA ligase b. glued together by RNA primers c. fused together by DNA polymerase d. formed into the lagging strand without splicingarrow_forwardA molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forwardThe following sequence of nucleotides is found in a single-stranded DNA template:ATTGCCAGATCATCCCAATAGATAssume that RNA polymerase proceeds along this template from left to right a. Which end of the DNA template is 5′ and which end is 3′?b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this templatearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Nucleic acids - DNA and RNA structure; Author: MEDSimplified;https://www.youtube.com/watch?v=0lZRAShqft0;License: Standard YouTube License, CC-BY