Concept explainers
(a)
Interpretation: Among the given base pairing situations, whether the base paring includes two DNA strands, a DNA strand and a RNA strand, or it might includes either two DNA strands or a DNA strand and an RNA strand has to be predicted.
Concept introduction: DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). RNA contains the complementary base pairs. The four complementary bases of RNA are adenine (A), uracil (U), guanine (G) and cytosine (C).
(b)
Interpretation: Among the given base pairing situations, whether the base paring includes two DNA strands, a DNA strand and a RNA strand, or it might includes either two DNA strands or a DNA strand and an RNA strand has to be predicted.
Concept introduction: DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). RNA contains the complementary base pairs. The four complementary bases of RNA are adenine (A), uracil (U), guanine (G) and cytosine (C).
(c)
Interpretation: Among the given base pairing situations, whether the base paring includes two DNA strands, a DNA strand and a RNA strand, or it might includes either two DNA strands or a DNA strand and an RNA strand has to be predicted.
Concept introduction: DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). RNA contains the complementary base pairs. The four complementary bases of RNA are adenine (A), uracil (U), guanine (G) and cytosine (C).
(d)
Interpretation: Among the given base pairing situations, whether the base paring includes two DNA strands, a DNA strand and a RNA strand, or it might includes either two DNA strands or a DNA strand and an RNA strand has to be predicted.
Concept introduction: DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). RNA contains the complementary base pairs. The four complementary bases of RNA are adenine (A), uracil (U), guanine (G) and cytosine (C).
Trending nowThis is a popular solution!
Chapter 22 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
- 11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…arrow_forwardif this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)arrow_forwardTo answer the prompts below, you will need to draw the chemical structure of the trinucleotide 5' - ACG - 3', labeling the 5' and 3' ends. Opposite this structure, draw the complementary trinucleotide to make a double-stranded DNA molecule. A. What is the complementary trinucleotide sequence from 5' to 3' (enter answer as e.g. CGA)? TCG B. How many non-covalent hydrogen bonds stabilize this structure? 8 C. How many covalent phosphate linkages stabilize this structure? 10 D. Which type of bond takes less energy to break? Phosphate linkage O Non-covalent hydrogen bondsarrow_forward
- The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forwardSuppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forwardChoose all of the statements that correctly describe the base pairs drawn below. A C H H-N -H-N N-H- -N B H D موعة Rita N -H---- 2 NHN O- -H-N H -H- N- -H-N The non-Watson-Crick base pair shown in A is much less stable than the base pairs shown in B and C, because the smaller size of the two pyrimidine bases induces a distortion in the structure of the double helix that decreases the stability of the helix when compared to helices with the normal Watson-Crick base pairs. The base pair shown in B is found in BOTH DNA and RNA The base pair shown in C is found ONLY in RNA and NOT DNA The base pair seen in B is more stable than the Watson-Crick base pair shown in C partly because of a larger number of hydrogen bonds and partly because of more favourable pi-stacking interactions with adjacent base pairs.arrow_forward
- Which of the following relations will be found in the percentages of bases of a double-stranded DNA molecule? a. A+T-G+C b. A+G=T+C A+C-G+T c. d. (A +T)/ (C+G) = 1.0 e. (A+G)/ (C+T)= 1.0 f. (A/C)=(G/T) g. (A/G)=(T/C) h. (A/T)=(G/C)arrow_forward1. Label the drawing at the right with the terms nucleotide, base pairing rules, and double helix. Write each term and draw a line that connects the term to the appropriate part of the drawing. AX P 010101010 80 Р PDP TCXA D. D C GXC P 0 CXG P P D A ICXA D P G D D CXG D TCXA DL D TCXA 0101010 D CXG P AXT D P P P P D 0 D P P P GCD LON Aarrow_forwardIn the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine content of the same strand. b. nucleotides are arranged in the A-form. c. purine content (fraction of bases that are purines) must be the same in both strands. d. two strands are parallel. e. the strands are complementary to each other.arrow_forward
- Which of the following statements are correct? explain your answers.A. A DNA strand has a polarity because its two ends contain different bases. B. G-C base pairs are more stable than A-T base pairs.arrow_forwardAssume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?arrow_forwardDraw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimensional structure of double-stranded DNA?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning