Pearson eText for Biochemistry: Concepts and Connections -- Instant Access (Pearson+)
2nd Edition
ISBN: 9780137533114
Author: Dean Appling, Spencer Anthony-Cahill
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 22, Problem 6P
The E. coli chromosome is 1.28 mm long. Under optimal conditions, the chromosome is replicated in 40 minutes.
- What is the distance traversed by one replication fork in 1 minute?
- If replicating DNA is in the B form (10.4 base pairs per turn), how many
nucleotides are incorporated in 1 minute in one replication fork? - If cultured human cells (such as HeLa cells) replicate 1.2 m of DNA during a five-hour S phase and at a rate of fork movement one-tenth of that seen in E. coli, how many origins of replication must the cells contain?
- What is the average distance, in kilobase pairs, between these origins?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Approximately how many high-energy bonds does DNA polymerase use to replicate a bacterial chromosome (ignoring helicase and other enzymes associated with the replication fork)? compared with its own dry weight of 10–12 g, how much glucose does a single bacterium need to provide enough energy to copy its DNA once?
The E. coli chromosome is 1.28 mm long. Under optimal conditions, thechromosome is replicated in 40 minutes.(a) What is the distance traversed by one replication fork in 1 minute?(b) If replicating DNA is in the B form (10.4 base pairs per turn), how manynucleotides are incorporated in 1 minute in one replication fork?(c) If cultured human cells (such as HeLa cells) replicate 1.2 m of DNAduring a five-hour S phase and at a rate of fork movement one-tenthof that seen in E. coli, how many origins of replication must the cellscontain?(d) What is the average distance, in kilobase pairs, between these origins?
The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be made in one round of DNA replication in a bacterial population containing 1000 bacteria?
Chapter 22 Solutions
Pearson eText for Biochemistry: Concepts and Connections -- Instant Access (Pearson+)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Are these answers correct? It's all for one problem where the E. coli chromosome contains 4,641,652 bp.arrow_forwardYou decide to repeat the Meselson-Stahl experiment, except this time you plan to grow the E. coli cells on light 14N medium for many generations and then transfer them to heavy 15N medium and allow them to grow for 2 additional generations (2 rounds of DNA replication). If the conservative model of DNA replication was correct, what is the expected distribution of DNA in the density gradient after two rounds of replication? Multiple Choice One band of intermediate density. One band of light density. One band of heavy density. One band of light density and one band of heavy density. One band of light density and one band of intermediate density.arrow_forwardBelow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.arrow_forward
- Matching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication forkarrow_forwardA bacterium synthesizes DNA at each replication fork at a rate of 1500 nucleotides per second. If this bacterium completely replicates its circular chromosome by theta replication in 20 minutes, how many base pairs of DNA will its chromosome contain?arrow_forwardSuppose that E. coli synthesizes DNA at a rate of 100,000 nucleotides per minute and takes 40 minutes to replicate its chromosome. (a) How many base pairs are present in the entire E. coli chromosome? (b) What is the physical length of the chromosome in its helical configuration—that is, what is the circumference of the chromosome if it were opened into a circle?arrow_forward
- E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope 15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N. Using a solid line to represent a heavy polynucleotide chain and a dashed line for a light chain, sketch each of the following descriptions:a. The heavy parental chromosome and the products of the first replication after transfer to a 14N medium, assuming that the chromosome is one DNA double helix and that replication is semiconservative.b. Repeat part a, but now assume that replication is conservative.c. If the daughter chromosomes from the first division in 14N are spun in a cesium chloride density gradient and a single band is obtained, which of the possibilities in parts a and b can be ruled out? Reconsider the Meselson and Stahl experiment: What does it prove?arrow_forwardThe transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505arrow_forwardYou are analyzing the intracellular DNA intermediates formed during the replication of the single-stranded (ss) DNA phage M13. In a replication mutant, you find accumulation of DNA molecules with the following properties:Results of a 0.7% agarose gel electrophoresis run at pH 8.0 – gel is running top tobottom, with the origin at the top of the diagram. The smudges indicate several bandswith slightly different migration rates. open circle M13closed circle M13 Left lane — markers (wild-type open circle M13 and closed circle M13)2nd lane — DNA extracted from mutant M13 phage cells3rd lane — DNA extracted from mutant M13 phage cells denatured4th lane — DNA extracted from normal M13 phage cellsRight lane — DNA extracted from normal M13 phage cells denaturedProfiles from a 5 – 20% sucrose gradient centrifuging of the mutant M13 phage DNA The arrow on the neutral (pH 7.4) gradient shows the position of the covalently closed circular DNA. On the alkaline (pH 12.5) gradient, note two peaks…arrow_forward
- Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?arrow_forwardIn bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the abovearrow_forwardA circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a replication fork is 100,000 nucleotides per minute, how much time will theta replication require to completely replicate the molecule, assuming that theta replication is bidirectional? How long will replication of this circular chromosome by rolling-circle replication take? Ignore replication of the displaced strand in rolling-circle replication.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY