Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 26, Problem 13EQ
Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted
A. Nanos mRNA injected into the anterior end of an oocyte
B. Antp protein injected into the posterior end of an embryo
C. Toll mRNA injected into the dorsal side of an early embryo
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Maternal and zygotic mRNAs regulate embryonic development by determining major body axes. Two of the these mRNAs code for the proteins ____ (of maternal origin) and (of zygotic origin), which are morphogens that accumulate at the end of the egg that will become the anterior end of the embryo, whereas two other mRNAs code for the morphogens ____ (maternal origin) and ____ (zygotic origin), which accumulate at the opposite end of the egg and determine the posterior end of the embryo. The dorso-ventral axis of the embryo is established by two morphogens coded for by maternal mRNAs: (1) ____, which is transcribed in the egg nucleus and accumulates in a crescent on the side of the egg that will become the dorsal surface; and (2) ____, which is transported after fertilization into blastodermal cells that will become the ventral surface, and in these cells activates the zygotic gene ____, which produces a protein that diffuses to the blatodermal cells at the opposite side of the egg and…
At the molecular level, how do you think a gain-of-function mutation in a developmental gene might cause it to be expressed in the wrong place or at the wrong time? Explain what type of DNA sequence would be altered.
In the sea urchin, early development may occur even in the presence of actinomycin D, which inhibits RNA synthesis. However, if actinomycin D is present early in development but is removed a few hours later, all development stops. In fact, if actinomycin D is present only between the sixth and eleventh hours of development, events that normally occur at the fifteenth hour are arrested. What conclusions can be drawn concerning the role of gene transcription between hours 6 and 15?
Chapter 26 Solutions
Genetics: Analysis and Principles
Ch. 26.1 - Prob. 1COMQCh. 26.1 - Prob. 2COMQCh. 26.1 - Which of the following is the correct order for...Ch. 26.2 - Prob. 1COMQCh. 26.2 - Prob. 2COMQCh. 26.2 - Prob. 3COMQCh. 26.2 - Prob. 4COMQCh. 26.3 - Prob. 1COMQCh. 26.3 - Prob. 2COMQCh. 26.3 - 3. Myogenic bHLH proteins are ___________ that...
Ch. 26.4 - Prob. 1COMQCh. 26.4 - Prob. 2COMQCh. 26.5 - 1. A key event that initially determines female or...Ch. 26.5 - Prob. 2COMQCh. 26 - 1. What four types of cellular processes must...Ch. 26 - Prob. 2CONQCh. 26 - Prob. 3CONQCh. 26 - 4. Which of the following statement(s) is/are true...Ch. 26 - Discuss the morphological differences between the...Ch. 26 - Prob. 6CONQCh. 26 - Explain what a morphogen is, and describe how it...Ch. 26 - 8. What is positional information? Discuss three...Ch. 26 - Prob. 9CONQCh. 26 - Prob. 10CONQCh. 26 - 11. Describe the function of the Bicoid protein....Ch. 26 - With regard to development, what are the roles of...Ch. 26 - Discuss the role of homeotic genes in development....Ch. 26 - Describe the molecular features of the homeobox...Ch. 26 - What would you predict to be the phenotype of...Ch. 26 - Prob. 16CONQCh. 26 - If a mutation in a homeotic gene produced the...Ch. 26 - 18. Explain how loss-of-function mutations in the...Ch. 26 - What is the difference between a maternal-effect...Ch. 26 - Prob. 20CONQCh. 26 - Prob. 21CONQCh. 26 - Prob. 22CONQCh. 26 - 23. Discuss the similarities and differences...Ch. 26 - 24. What is cell differentiation? Discuss the role...Ch. 26 - Prob. 25CONQCh. 26 - What is a totipotent cell? In each of the...Ch. 26 - 27. What is a meristem? Explain the role of...Ch. 26 - Prob. 28CONQCh. 26 - Predict the phenotypic consequences of each of the...Ch. 26 - 30. Explain how alternative splicing affects sex...Ch. 26 - Prob. 1EQCh. 26 - Compare and contrast the experimental advantages...Ch. 26 - 3. What is meant by the term cell fate? What is a...Ch. 26 - 4. Explain why a cell lineage diagram is necessary...Ch. 26 - Explain the rationale behind the use of the bag of...Ch. 26 - Prob. 6EQCh. 26 - Take a look at question 2 in More Genetic TIPS...Ch. 26 - All of the homeotic genes inDrosophilahave been...Ch. 26 - Prob. 9EQCh. 26 - wo techniques commonly used to study the...Ch. 26 - Prob. 11EQCh. 26 - Prob. 12EQCh. 26 - 13. Another way to study the role of proteins...Ch. 26 - 14. Why have geneticists used reverse genetics to...Ch. 26 - Prob. 1QSDCCh. 26 - Prob. 2QSDCCh. 26 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene in yeast is always producing mRNA, but the Gcn4 protein is only made when the cells are starved. B. What does this mean for diagnostic techniques that try to look at gene expression?arrow_forwardWhen doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What are the controls you should use and why use these? What is special about the genomic DNA? What do you expect to find (using these genomic DNA samples)? please help!arrow_forwardYou found a strain of mutant fruit flies (Drosophila) living on the rotten bananas in your dorm room. You notice that many of the larvae have abnormal abdominal segments. You want to know if the “abdomenless” mutation is a maternal effect gene. Describe an experiment you would do to determine this, and the results that would support and contradict the notion that the abdomenless gene encodes a maternal determinant.arrow_forward
- Which of the following statements about Tbx5 is true? a. Tbx5, Tbx4, and AmphiTbx4/5 have very similar coding regions. b. Tbx5 is involved in tail development in vertebrates. c. Tbx5, Tbx4, and AmphiTbx4/5 have very similar regulatory regions. d. Tbx5 initiates hindlimb development.arrow_forwardWhat is the purpose of syncytin, the protein product of sequences originally added to the human genome from a retrovirus, as it relates to early fetal development in human reproduction?arrow_forwardgiven a situation in which you manipulated a zebrafish embryo by injecting high levels of retinoic acid so that no anterior genes will be expressed. Surprisingly, after embryonic development, you are still able to observed the presence of anterior structures. What could explain this observation? What changes in your experiment would you make to achieve your objective?arrow_forward
- In recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed . Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an eggcell, only a small percentage of the resulting embryos complete development, and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred to an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science 293:1095–1098). Propose a possible reason for why a higher percentage of cloned embryos develop successfully when the nucleus transferred comes from an undifferentiated embryonic stem cell.arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardA mouse gene was identified and determined to be required for formation of heart muscle. A gene with a similar sequence was identified in the human genome. What experiment could scientists do to determine if the mouse and human genes have similar functions? A. The scientist could place the normal human gene into normal mice and see if the resulting mice are viable. B. The scientist could search the human genome for genes that encode proteins that are identical to the protein encoded by the mouse gene. C. The scientist could place the normal human gene into mutant mice to see if heart muscle forms in the mouse. D. The scientist could place the mutant mouse gene into humans to see if humans develop without heart muscle.arrow_forward
- In flies, the gap gene kruppel is expressed in a broad band in the middle of the embryo with giant expressed as its anterior border and knirps at its posterior border. How is the expression of kruppel limited to this band in the embryo? Describe the spatial regulation of the kruppel gene.arrow_forwardHow have we discovered that specific genes control development in an organism like Drosophila?arrow_forwardYou observe that a particular gene is being transcribed during development. How can you tell whether the expression of this gene is under transcriptional or translational control?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY