![EBK FUNDAMENTALS OF GENERAL, ORGANIC, A](https://www.bartleby.com/isbn_cover_images/8220102895805/8220102895805_largeCoverImage.jpg)
Concept explainers
Interpretation:
The three different base triplets that could be combined to code for the given amino acids Leu-Leu-Leu has to be predicted.
Concept Introduction:
Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three-
Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis.
Illustrated relationships are:
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
protein: Met Pro Val Gly His Leu Ser
Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 26 Solutions
EBK FUNDAMENTALS OF GENERAL, ORGANIC, A
- Polypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardAnother thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.arrow_forward
- Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can result from alternative splicing of this RNA.arrow_forwardConsider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?arrow_forwardUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forward
- In eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.arrow_forwardif a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV data showed that it contains 0.67 % Tyrosine amino acid by weight. How many Tyrosine amino acids this protein contain? If this protein that was formed contains a total of 865 amino acids long, how many nucleic acids are there in the mRNA including the initiator and the terminator codons?arrow_forwardGiven the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?arrow_forward
- A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardThe genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lysarrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)