Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 12P
Interpretation Introduction
Interpretation:
The method of identifying whether a methionyl-tRNA initiates the synthesis of protein or delivers a Met residue to incorporate in the polypeptide chain by bacterial cells needs to be determined. The difference in the Met codon for the two purposes needs to be explained. The role of eukaryotic cells in handling such problems needs to be explained.
Concept Introduction:
The polypeptide chains are formed from the amino acids joining together by peptide bonds. The proteins are known to be
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Question:-
Fill the Blank!
In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during translation initiation, while in eukaryotes, the _______ consensus sequence of mRNA contains the_____.
2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find enough space to do so. Once a small ribosomal subunit has bound to an mRNA, it will scan along that mRNA in the 5' to 3' direction looking for a start codon at which to initiate translation. How does the small ribosomal subunit distinguish a start codon from any other AUG codon that simply codes for methionine in the middle of a coding sequence?
From this overall anticodon sequence in tRNA,
3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5'
Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.arrow_forwardWhich anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one possible answer? If so, state any alternative answers.arrow_forwardTranslation What are the stop/nonsense codons? How is the growing polypeptide released from the ribosomal assembly?arrow_forward
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusarrow_forward5’-AUGCCGGACUGAAAU-3’ What is the sequence of the resulting protein assuming the ribosome takes the first AUG as triplet codon ?arrow_forwardmRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.arrow_forward
- Explain the interactions of specific tRNA with its synthetase, by including the importance of cloverleaf structure of tRNA, which domains are involved, distinct recognition sites, D-arm, TψC arm, anticodon loop and stem, linkage, activation, amino acceptor arm, ensuring the correct tRNA to be recognized by its synthetase. Please do not answer with an incredibly long reply. I would just like the most condensed answer possible by providing all key points asked about. Thanks!arrow_forwardFor the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.arrow_forwardPlease help me complete this solution, i cant figure out what is incoorect about this statement... is the Rrna nee to be repleced with Trna?arrow_forward
- Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible nucleotide sequence in the template strand of the gene that codes for met-enkephalin, assuming that every base of the gene is transcribed and then translated?arrow_forward1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forward36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY