Biochemistry: Concepts and Connections
1st Edition
ISBN: 9780321839923
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 4, Problem 12P
Would you expect Neurospora crassa DNA to have a higher or lower Tm than human DNA (see page 81)? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Ethanol (CH3-CH2-OH) is miscible in water because it is
able to form hydrogen bonds with itself and other molecules. However, its structure only allows it to form 1-2 hydrogen bonds. This is one reason why even low concentrations of ethanol in solution are lethal for cells.
Based on this information, explain why we can use high concentrations of ethanol to precipitate DNA out of solution.
Also, describe/predict the effects of increasing concentrations of ethanol in (and around) a cell on macro-molecular interactions (i.e. on weak bonds).
Finally, it is possible to select for yeast that are tolerant to increased concentrations of ethanol. Give an example of a physiological change in yeast cells that might make them resistant to ethanol.
The DNA from sea urchins contains about 32% A and about 18% G. What percentages of T and C would you expect in sea urchin DNA? Explain.
The sequences of several short single-stranded DNA
molecules are shown below. Imagine each sequence as
a typical double-stranded DNA molecule, with
antiparallel strands held together by Watson-Crick base-
pairs between the complementary bases. Which of
these double-stranded molecules would have the
highest melting temperature (Tm)?
5' ACTGAGTCTCTGACTAGTCT 3'
5' ACTTAGTCTATGACTAGTCT 3'
5' ACTTAATCTATGAATAGTCT 3'
5' ACTGCGTCTCCGACTAGTCT
3'
5' ACTGCGTCTCCGACGAGCCT 3'
Chapter 4 Solutions
Biochemistry: Concepts and Connections
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- With regard to Chargaff’s experiment described in Figure shown,answer the following:A. What is the purpose of paper chromatography?B. Explain why it is necessary to remove the bases in order todetermine the base composition of DNA.C. Would Chargaff’s experiments have been convincing if theyhad been done on DNA from only one species? Discuss.arrow_forwardA plot showing the % of denaturation as a function of temperature for a melting point of a DNA sample under 0.12 M NaCl gives an equation of a line of Y= 0.0074 X - 0.044. (where Y is the % of denaturation and X is the temperature in °C) Question: Calculate the melting point of this DNA in °C.arrow_forwardIn sheep DNA, the mol % of adenine (A) was found to be 28.3. Based on Chargaff's rule, what would be the approximate mol % of G, C, and T? mol % of G = mol % of C = mol % of T =arrow_forward
- The relative proportions of cytosine-guanine and adeninethymine bonds in a DNA sample can be estimated by measuring its “melting temperature,” the temperature at which half of the DNA strands have pulled apart. Samples with a high percentage of cytosine-guanine pairs have a higher melting temperature than samples with a high percentage of adeninethymine pairs. Explain why this is so, considering the nature of the bonds that hold the base pairs together (look back at as shown).arrow_forwardThe two sides of the DNA double helix are connected by pairs of bases (adenine, thymine, cytosine, and guanine). Because of the geometric shape of these molecules, adenine bonds with thymine and cytosine bonds with guanine. The figure (Figure 1) shows the thymine-adenine bond. Each charge shown is ±e, and the H−N distance is 0.110 nm . Calculate the net force that thymine exerts on adenine. To keep the calculations fairly simple, yet reasonable, consider only the forces due to the O−H−N and the N−H−N combinations, assuming that these two combinations are parallel to each other. Remember, however, that in the O−H−N set, the O− exerts a force on both the H+ and the N−, and likewise along the N−H−N set. Express your answer in newtons. Is the net force attractive or repulsive?arrow_forwardEthanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due to a higher dielectric constant than water. True or False?arrow_forward
- A plot showing the % of denautration as a function of temperature for a melting point of a DNA sample under 0.12 M NaCl gives an equation of a line of Y= 0.0074 X - 0.044 (Where Y is the % of denautration and X is the temperature in degree C) This is all the information that was given. 1. Calcuate the melting point of this DNA in degree Carrow_forwardThe DNA of a skin sell and a muscle cell are identical. But the skin cell may contain the proteins collagen and keratin in high amount, which the muscle lacks (or has very little of), while the muscle cell may have large amounts of the proteins actin and myosin, which the skin cell lacks (or has very little of). Explain this apparent contradiction.arrow_forwardWhat observations are consistent with the conclusion that DNA serves as the genetic material in eukaryotes? List and discuss them.arrow_forward
- Using the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) Barrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).2.2. Describe what are missense mutations and its effects on structure and function usinghaemoglobin as an example (8).5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’arrow_forwardhttps://drive.google.com/file/d/1fOtSuZ_NNdi7qRXHCkM6mtvwRS0pl8u6/view?usp=sharing Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models in Figure 1. Do you expect the same values for other DNA and RNA models that will be constructed for instance? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license