![Biochemistry: Concepts and Connections](https://www.bartleby.com/isbn_cover_images/9780321839923/9780321839923_largeCoverImage.gif)
Biochemistry: Concepts and Connections
1st Edition
ISBN: 9780321839923
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 4, Problem 9P
Suppose that you centrifuged a transfer RNA molecule to equilibrium in an alkaline CsCl gradient, as described in Problem 7. What result would you expect?
7. For some DNAs, it is possible to separate the two strands, after denaturation, in a CsCl gradient.
a. What property of any DNA determines where it will band in a CsCl?
b. What kind of DNA might have two strands that differ sufficiently in this property that they could be separated after denaturation?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
One of the useful rules of thumb that you may have learned in Biochemistry, is that a 50 g/ml solution of DNA has an absorbance of about 1.0 in a 1 cm cell.
A. I have a solution of DNA that has a transmittance of 0.15 when it is placed in a cell with a 200 um pathlength. What is the concentration of DNA in this solution? (in units of g/ml)
B. Assume that this DNA is a synthetic oligo containing 25 base pairs, and that the MW of a single base pair has a molecular weight of 330. What is the molar concentration of duplex DNA molecules in the solution?
C. What is the Molar absorptivity of DNA in units of L cm (mol base pair) -1 -1
For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a) What property of any DNA determines where it will band in a CsClgradient?(b) What kind of DNA might have two strands that differ sufficiently in thisproperty that they could be separated after denaturation?
Consider the following DNA strand with the following nucleotide sequence:
3’-ATATCAGAGAATATCA-5’
The nucleotide sequence of the complementary DNA strand is .
b. The nucleotide sequence of the antisense strand used in the transcription process is .
c. The nucleotide sequence of the mRNA strand produced after the transcription process is
2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol).
% A?
%C?
%G?
Chapter 4 Solutions
Biochemistry: Concepts and Connections
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- The melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)arrow_forward29.) equalities now called Chargaff's rule. Biochemist Erwin Chargaff was the first to note that, in DNA, [A]=[T] and [G]=[C], A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C] = [G] [T] = 20% %3D - B) If a single strand of RNA is 20% uracil, what can you predict about the percentages of the remaining bases and why?arrow_forwardSuppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forward
- Assume that a poly(A) tract five base pairs long produces a 20° bend in aDNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA)5 tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helixarrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (32) (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D). 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’arrow_forward(i) (.:, From the diagram to the right of the trp repressor in its approximate binding relationship to a double-stranded DNA mole- cule, what is the relative orientation of the macrodipoles of helices 4 and 5 to each other? Indicate the N-terminal ends of helices 4 and DNA 5 5? Which residue in the sequence above is the N-terminal residue of each helix? N N (ii) :. Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dis- sociable groups (assume pH 7). Indicate the charge of both residues for each pair. C.arrow_forward
- The High Mobility Group (HMG) proteins are architectural regulators of DNA. Many HMG proteins are phosphorylated at certain serine residues. How would phosphorylation change the binding affinity of HMG proteins to DNA?arrow_forwarda) It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…arrow_forwardWhere do you predict the N- and C-termini are located for Max? Match the words in the left column to the appropriate blanks in the sentences on the right. electrostatic dispersion negative C-terminus positive positively negatively N-terminus The Reset Help is interacting with the DNA. The first reason for this is because the a-amino group is positively charged and will interact favorably with the of the charge on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNAarrow_forward
- Cisplatin preferentially binds N? of the purines adenine and guanine. Draw the product of the following reaction: 3. 2+ `NH H3N. H20 `NH2 ? H3N `H2O 4. Draw the structure of transplatin and discuss its possible interaction with DNA.arrow_forward"Five prime to three prime" description of a DNA strand refers to: A. the phosphodiester backbone of DNA. B. the phosphorylated 5' carbon at one end, the 3' at the other end. C. the phosphorylated 5' carbon on one sugar and the 3' carbon on the next sugar. D. the location of the hydroxyl groups. KM of a Michaelis–Menten is proportional to: A. The concentration of the ES complex B. The concentration of the substrate C. Both A and B D. Neither A nor Barrow_forwardIn the image attached, there are 4 nitrogenous bases plus ribose used to generate strands of DNA. They are oriented with hydrogen bonding regions aligned. A. Diagram the chemical structure of cytosine hydrogen-bonded to guanine in normal DNA. Please show the H bond interactions clearly with a dotted line. B. In a second diagram, show the enol form of cytosine following a tautomeric shift. Include in the diagram how this change shifts hydrogen bonding characteristics and a new binding partner for this nucleotide.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license