![Biochemistry: Concepts and Connections](https://www.bartleby.com/isbn_cover_images/9780321839923/9780321839923_largeCoverImage.gif)
Biochemistry: Concepts and Connections
1st Edition
ISBN: 9780321839923
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 4, Problem 3P
pppApCpCpupApGpApu-OH
a. Using the straight-chain sugar convention shown on page 79, write the structure of the DNA strand that encoded this short stretch of RNA
b. Using the simplest convention for representing the DNA base sequence (page 79), write the structure of the nontemplate DNA strand.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.
5’ - A T G G C C C A A C T G A C C - 3’
a. How many nucleotides are listed here
b. How many codons are listed here
c. What are the three structural components of one nucleotide
D.Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5’ and which end is 3
E.If the above sequence is the coding strand, write the RNA strand that will be transcribed
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’
1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
Chapter 4 Solutions
Biochemistry: Concepts and Connections
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.arrow_forward2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).arrow_forward2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D). 2.2. Describe what are missense mutations and its effects on structure and function usinghaemoglobin as an example .arrow_forward
- Name a.) ( pair. Indicate hydrogen bonds with dashed lines, number the atoms in the bases according to IUPAC convention, and circle the pyrimidine. Additionally, indicate where the sugar is attached to the base, the major groove, and the minor groove. 8.) Looking at the bases from above, draw a Watson-Crick C-G base b.) ( triple helix (shown below). In this triple helix, a third strand binds in the major groove via base pairs with the existing Watson-Crick bases. This additional base pair is called a Hoogsteen base pair and is indicated by an asterisk followed by the third base. On your drawing add a cytosine in the appropriate location to indicate a CG*C base pair. , it is possible for nucleic acids to form a structure known as a c.) ( between turns, glycosidic bond conformation and sugar conformation differs between A-form DNA and Z-form DNA, Which one is PNA? Indicate (possibly using a table) how the strand width, distancearrow_forward29.) equalities now called Chargaff's rule. Biochemist Erwin Chargaff was the first to note that, in DNA, [A]=[T] and [G]=[C], A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C] = [G] [T] = 20% %3D - B) If a single strand of RNA is 20% uracil, what can you predict about the percentages of the remaining bases and why?arrow_forwardIf a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAGarrow_forward
- If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAGarrow_forwardFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…arrow_forward5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.arrow_forward
- What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTarrow_forwardWhat is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGATarrow_forward5' G-A-T-A-с-А-А-с-А-т-G-6-A-с-А-т-G-А-с-т3 What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license