Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 6, Problem 15P
Interpretation Introduction
Interpretation:
A method to determine the most appropriate gap penalty should be suggested.
Concept introduction:
Gap penalty is a scoring method used in sequential alignment of two or more sequences. Introducing gaps to sequences will match more
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
When comparing (i.e., aligning) two or more genetic sequences, itis sometimes necessary to put in gaps. Explain why. Discuss twochanges (i.e., two types of mutations) that could happen during theevolution of homologous genes that would explain the occurrenceof gaps in a multiple-sequence alignment.
Consider three different kinds of human libraries: agenomic library, a brain cDNA library, and a livercDNA library.a. Suppose that all three of these libraries are sufficiently large so as to represent all of the differenthuman nucleotide sequences that the library couldpossibly include. Which of these libraries wouldthen correspond to the largest fraction of the totalhuman genome?b. Would you expect any of these libraries not tooverlap the others at all in terms of the sequences itcontains? Explain.c. How do these three libraries differ in terms of thestarting material for constructing the clones in thelibrary?d. Why would you need to sequence many clonesfrom many cDNA libraries to annotate a genome?
How are the gap penalties adjusted in the ClustalW multiple sequence alignment program to improve the algorithm? Indicate the logic only.
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) of conserved sequences at the DNA level versus the Amino Acid level? Please site references if possible and have 5+ sentences.arrow_forwardLet’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the difficulties ofsequencing long repeated sequences, what other problems mightyou encounter in assembling these fragments?arrow_forwardalignment in genomic research, list types of alignments and corresponding errors associated with specific sequence assemblies. Are there methods of alignment error filtering?arrow_forward
- Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences. asaparrow_forwardwhy is gap opening penalized more than gap extension in doing alignment of sequence similarity?arrow_forwardS1: ACGTCATCA S2: TAGTGTCA How many global alignments generate the same maximum score?arrow_forward
- Assumptions: -There are approximately 3,000,000,000 base paris in the mammalian genome (genes constitute only a portion only a portion of this total. -There are approximately 10,000 genes in the mammalian genome. - A single gene averages 10,000 base pairs in size. -Only 1 out of 3 mutation that occur in gene result in a chnage to the protein structure. In the mammalian genome: How many total base-pairs are in all the mammalian genes? what proportion (%) of the total genome does this represent? What is the probability that a random mutation will occur in any given gene? What is the probability mutation will change the structure of a protein?arrow_forwardAssuming that the mean size of the human sau3AI partially digested fragments clones is 3kb, calculate the proportion of the human genome represented in all libraries prepared by the class. Use a value of 3,000,000kb for the size of the human genome. You also need to know that the whole 'class' generated 3,514 white colonies on plate 2.arrow_forwardDescribe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is NGS advantageous over Sanger based sequencing?arrow_forward
- You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.arrow_forwardThe human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…arrow_forwardIn the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is shown below. There is a stack at eachposition, even if short, because the sequence logo includes moredata. (a) Which three positions in this sequence logo have the mostpredictable bases? Name the most frequent base at each. (b) Whichfour positions have the least predictable bases? How can you tell?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY 
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License