Microbiology Fundamentals: A Clinical Approach
3rd Edition
ISBN: 9781259709227
Author: Marjorie Kelly Cowan Professor, Heidi Smith
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 11Q
Examine the DNA triplets here and determine the amino acid sequence they code for. Then provide a different DNA sequence that will produce the same protein. TAC CAG ATA CAC TCC CCT
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A set of nucleotides in an original DNA strand reads TACGCGAAT transcribe the short DNA sequence.
translate the short DNA sequence.
View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function.
https://www.youtube.com/watch?v=o_-6JXLYS-k
A DNA nucleotide triplet that codes for the amino acid proline is
a.
CCU
b.
GCA
c.
CCC
d.
GGT
Chapter 8 Solutions
Microbiology Fundamentals: A Clinical Approach
Ch. 8.1 - Define the terms genome and gene.Ch. 8.1 - Differentiate between genotype and phenotype.Ch. 8.1 - Draw a segment of DNA, labeling all important...Ch. 8.1 - Summarize the steps of bacterial DNA replication,...Ch. 8.1 - Compare and contrast the synthesis of leading and...Ch. 8.1 - Prob. 1NPCh. 8.2 - Provide an overview of the relationship among DNA,...Ch. 8.2 - Identify important structural and functional...Ch. 8.2 - Draw a picture of the process of transcription.Ch. 8.2 - List the three types of RNA directly involved in...
Ch. 8.2 - Prob. 10AYPCh. 8.2 - Identify the locations of the promoter, the start...Ch. 8.2 - Indicate how eukaryotic transcription and...Ch. 8.2 - NCLEX PREP 2. The following are all true of RNA,...Ch. 8.2 - Prob. 3NPCh. 8.3 - Define the term operon, and explain one advantage...Ch. 8.3 - Prob. 14AYPCh. 8.4 - Prob. 15AYPCh. 8.4 - Prob. 16AYPCh. 8.5 - Prob. 17AYPCh. 8.5 - Differentiate among frameshift, nonsense, silent,...Ch. 8.5 - Prob. 19AYPCh. 8.5 - Prob. 1MMCh. 8.6 - Explain the importance of restriction...Ch. 8.6 - List the steps in the polymerase chain reaction.Ch. 8.6 - Describe how you can clone a gene into a...Ch. 8.6 - Prob. 23AYPCh. 8.6 - Prob. 24AYPCh. 8.6 - Name two genetic techniques that are designed to...Ch. 8.6 - NCLEX PREF 4. A client is being treated with...Ch. 8.6 - Prob. 2MMCh. 8 - Single nucleotide polymorphisms are found in a....Ch. 8 - Using your knowledge of DNA from this chapter,...Ch. 8 - Conduct research on CRISPR and explain in...Ch. 8 - Which of the following is a characteristic of RNA?...Ch. 8 - List some advantages and disadvantages to a cell...Ch. 8 - Construct an argument for why tRNA contains a lot...Ch. 8 - Prob. 7QCh. 8 - Discuss the intersection between the metabolome...Ch. 8 - Defend this statement: All of biology is dependent...Ch. 8 - DNA is semiconservative because the ______ strand...Ch. 8 - Examine the DNA triplets here and determine the...Ch. 8 - Prob. 12QCh. 8 - Prob. 13QCh. 8 - Prob. 14QCh. 8 - Metagenomics is providing insight into the...Ch. 8 - The creation of biological molecules and cells...Ch. 8 - Prob. 17QCh. 8 - Genetically modified organisms (GMOs)especially in...Ch. 8 - Prob. 19QCh. 8 - Construct an analogy using your clothes closet to...Ch. 8 - Prob. 21QCh. 8 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A chromosome contains many different gene regions that are transcribed into different ________. a. proteins c. RNAs b. polypeptides d. DNA strandsarrow_forwardEnergy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ________. a. the nucleotide b. DNA polymerase c. phosphate-group transfers from ATParrow_forwardUse the three letter code for amino acids. If they stop codon is encountered use the word stop without quotation marks. A set of nucleotides in an original DNA strand reads: CTA CTC TTT. Transcribe the short DNA sequence. Then translate the same sequence. arrow_forward
- Examine the following sequence of DNA3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG – ACT – AGG-5’Write out the complementary DNA sequence (identify 3’ and 5’ ends)Write out the complementary mRNA sequenceWrite out the peptide sequence this DNA encodesarrow_forwardThe DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’arrow_forwardThe sequence of one strand of DNA is ACCTGC. What is the sequence of the complimentary strand of DNA? A. ACCTCG B. TGGACG C. UGGAGC D. ACCUGCarrow_forward
- Given the DNA molecule, draw the complementary piece under: TAGCTTAGCGarrow_forwardCreate the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’arrow_forwardWhat would be the complementary strand of DNA below? 3’-ACGTGCTACGGTACG-5’arrow_forward
- What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCTCATTGCTAC 3' 3' TGGAGTAACGATG 5'arrow_forwardGive the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'arrow_forwardSelect the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License