BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
9th Edition
ISBN: 2818000069358
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9, Problem 12P
Interpretation Introduction
Interpretation:
An explanation regarding the termination of reaction in which a restriction enzyme cleaves DNA by the addition of EDTA is to be stated.
Concept introduction:
The restriction enzymes are also called as restriction endonucleases. The restriction endonucleases are used for the hydrolysis of the phosphodiester backbone present on the DNA sequence. These restriction enzymes are BamHI obtained from bacillus amyloliquifaciens, SmaI obtained from Serratia marcescens and many others.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
True or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene)
and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil
you
appear blue.
IPTG &
X-Gal &
NO colonies
Amp
E. coli JM109
E. coli JM109
50 mM calcium
chloride-15% glycerol
lac
lac
lac
IPTG &
I Recovery
X-Gal
solution at -702C
PBSKS
White colonies
E. coli JM109
E. coli JM109
ampR
amp I
amp
lac
lac
Heat Shock
Non-transformed
42°C
E. coli JM109
E. coli JM109
amps
amps
lac
lac
IPTG &
X-Gal
lac I
Recovery
lac
PBSKS
BLUE colonies
PBSKS
ampRI
(amp
Transformed
IPTG &
X-Gal &
BLUE colonies
Amp
Hypotheses: Circle the correct answer
1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin.
a. Why?
_
2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B-
galactosidase enzyme.
a. Why?_
3. If…
Chapter 9 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardIn the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forward
- In DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?arrow_forwardplease help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forwardTrue or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forward
- Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardThis is DWA. You hope to clone an extinct animal species by taking the easy route - using museum bones or tissues. You extract the DNA and use PCR to amplify, then sequence all segments of the genome You are unsuccessful. Later you discover that the museum specimens have been treated with formaldehyde, which forms covalent bonds in DNA, where once there existed H-bonds. What step in your PCR reaction would be inhibited? g -S Knowing this, if a human was exposed to formaldehyde, what enzyme(s) of DNA replication in vivo would be prevented from doing their job?arrow_forwardRestriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864arrow_forward
- Question. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forwardPlease help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardtransformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license