Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 7P
Interpretation Introduction
Interpretation:
If the addition of one gene encoding a restriction endonuclease by horizontal gene transfer is beneficial or not is to be stated.
Concept introduction:
The restriction enzymes are also called as restriction endonucleases. The restriction endonucleases are used for the hydrolysis of the phosphodiester backbone present on the particular DNA sequence.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:
a)requires all four ribonucleoside triphosphates and a DNA template.
b)can extend an RNA chain and initiate a new chain.
c)recognizes specific start signals in DNA.
d)produces an RNA polymer that begins with a 5'-triphosphate.
e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Regulation of Genes and Their products
1. Given the following genotypes, explain how the mutation (identified by a (-) superscript) wil affect E. coll grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the lac operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not?
a. I+p+o+z- y+
b. i- p+o+z+y+
c. i+p+o- z+y+
d. i+p- o+z+y+
2. In terms of the trp operon, differentiate between two normal bacterial cultures, one grown in a medium supplied with tryptophan and the other medium without tryptophan.
3. Experiments show that mutations at gene E lead to non-repressible transcription of trp genes. Why?
How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Transformation and sequence validation of the clonesarrow_forwardsignal transduction- yeast genetics In one sentence, what is the URA3- to URA3+ conversion with plasmid transformation? Why is it necessary to do this first?arrow_forwardTrue or False? Eukaryotic genomes are organized into operons; each operon consists of a series of genes which code for enzymes involved in a metabolic pathway, under the transcriptional control of a single promoter sequence .arrow_forward
- gene cloning of amplified gene with enzmesarrow_forwardBacteria or Eukaryotes? Formation of a termination loop within the transcript Alternative splicing of transcripts Translation beginning before transcription is complete Cleavage following the AAUAAA signal Direct binding of RNA polymerase to promoterarrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forward
- - cytogenetics- Give me an example of make up a crime scene scenario in which DNA from a nonhuman provided critical evidence.arrow_forwardCOMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCarrow_forwardPLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this? arrow_forward
- MRNA- based therapeutics The following questions: Which research group has initially developed the technology? What was the purpose behind the invention of the technology? What type of questions could be answered with the technology? What are the applications of the technology? Are there any clinical trials associated with the method? What is the mechanism of action for the technology?arrow_forwardGeneral Biology - Help me do this activity, you can read the instructions for clarification, thanks!arrow_forwardQuestion:- Describe the function of each of the following Shortly. a. Amino-acyl tRNA synthetase b. E coll release factors 1 and 2 (RF1 and RF2) c. 5' methyl-guanosine cap d. Ribosomal P sitearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license