Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter ST.1, Problem 4DQ
Recall (from Chapter 18) how miRNAs and the RNA-induced silencing complex (RISC) regulate gene expression in eukaryotes. What about that system is conceptually similar to the CRISPR-Cas system? What is conceptually different?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Hello, is this correct?
What would a scientist need to use CRISPR-Cas system to introduce a specific point mutation into a gene?
Check All That Apply
Cas1 geneCas1 gene
Cas9 geneCas9 gene
sgRNAsgRNA
donor DNAdonor DNA
bacteriophage DNA
Compare and contrast anti-miRNA oligonucleotides, locked nucleicacids (LNAs), and antagomirs, which may eventually be used to treat certain forms of cancer.
Which of the following statements is not true about the guide RNA (see this interactive demonstration for help with this question: https://www.biointeractive.org/classroom-resources/crispr-cas9-mechanism-applications)
Group of answer choices
it contains a sequence of 20 nucleotides that matches a specific sequence in a cell’s DNA
When the guide RNA is combined with Cas9, it will guide Cas9 to the target sequence
its target sequence can be almost any sequence as long as it occurs near a PAM motif
it is a nuclease, a type of enzyme that cleaves DNA
Chapter ST Solutions
Concepts of Genetics (12th Edition)
Ch. ST.1 - What is the difference between innate immunity and...Ch. ST.1 - What evidence demonstrates that CRISPR-Cas is an...Ch. ST.1 - Prob. 3RQCh. ST.1 - Why was the type II CRISPR-Cas9 system of S....Ch. ST.1 - Prob. 5RQCh. ST.1 - What is a single guide RNA, and what role does it...Ch. ST.1 - What is the difference between nonhomologous...Ch. ST.1 - Prob. 8RQCh. ST.1 - Prob. 9RQCh. ST.1 - Prob. 1DQ
Ch. ST.1 - Prob. 2DQCh. ST.1 - What ethical and safety considerations must be...Ch. ST.1 - Recall (from Chapter 18) how miRNAs and the...Ch. ST.1 - Describe two different ways in which engineered...Ch. ST.1 - Consider the following human genetic diseases:...Ch. ST.1 - What are the different concerns about off-target...Ch. ST.2 - What is VNTR profiling, and what are the...Ch. ST.2 - Prob. 2RQCh. ST.2 - Describe capillary electrophoresis. How does this...Ch. ST.2 - What are the advantages and limitations of...Ch. ST.2 - Prob. 5RQCh. ST.2 - Explain why mitochondrial DNA profiling is often...Ch. ST.2 - Prob. 7RQCh. ST.2 - Describe the database system known as CODIS. What...Ch. ST.2 - Prob. 9RQCh. ST.2 - Prob. 10RQCh. ST.2 - Given the possibility that synthetic DNA could be...Ch. ST.2 - Prob. 2DQCh. ST.2 - If you were acting as a defense lawyer in a murder...Ch. ST.2 - The phenomena of somatic mosaicism and chimerism...Ch. ST.3 - What is pharmacogenomics, and how does it differ...Ch. ST.3 - Describe how the drug Herceptin works. What types...Ch. ST.3 - Prob. 3RQCh. ST.3 - Prob. 4RQCh. ST.3 - Prob. 5RQCh. ST.3 - Prob. 6RQCh. ST.3 - Why is it necessary to examine gene-expression...Ch. ST.3 - Prob. 8RQCh. ST.3 - Prob. 1DQCh. ST.3 - Prob. 2DQCh. ST.3 - How can we ensure that a patients privacy is...Ch. ST.3 - As gene tests and genomic sequences become more...Ch. ST.4 - How do genetically modified organisms compare with...Ch. ST.4 - Prob. 2RQCh. ST.4 - Prob. 3RQCh. ST.4 - Prob. 4RQCh. ST.4 - Describe the mechanisms by which the Cry proteins...Ch. ST.4 - Prob. 6RQCh. ST.4 - Prob. 7RQCh. ST.4 - Describe how plants can be transformed using...Ch. ST.4 - How do positive and negative selection techniques...Ch. ST.4 - Prob. 10RQCh. ST.4 - What are the laws regulating the development,...Ch. ST.4 - Do you think that foods containing GM ingredients...Ch. ST.4 - Prob. 3DQCh. ST.5 - What is gene therapy?Ch. ST.5 - Prob. 2RQCh. ST.5 - When treating a person by gene therapy, is it...Ch. ST.5 - Describe two ways that therapeutic genes can be...Ch. ST.5 - Explain how viral vectors can be used for gene...Ch. ST.5 - Prob. 6RQCh. ST.5 - Explain an example of a successful gene therapy...Ch. ST.5 - Prob. 8RQCh. ST.5 - Prob. 9RQCh. ST.5 - Prob. 10RQCh. ST.5 - Prob. 11RQCh. ST.5 - Prob. 1DQCh. ST.5 - Who should be treated by gene therapy? What...Ch. ST.5 - The lifetime costs for treatment of conditions...Ch. ST.5 - Should CRISPR-Cas or other techniques be used for...Ch. ST.5 - Prob. 5DQCh. ST.6 - What are RFLP markers and how were they used to...Ch. ST.6 - Why was information from Nancy Wexlers large...Ch. ST.6 - How do aggregates of mHTT protein form?Ch. ST.6 - Why are the results from the inducible mouse model...Ch. ST.6 - Based on the results from mouse models, is it...Ch. ST.6 - What do the results from creating transgenic mice...Ch. ST.6 - What steps lead from the binding of the mHTT...Ch. ST.6 - Summarize the approaches to therapy designed to...Ch. ST.6 - There are nine known progressive neurodegenerative...Ch. ST.6 - Prob. 2DQCh. ST.6 - Prob. 3DQCh. ST.6 - Why is there an inverse correlation between the...Ch. ST.6 - Discuss the ethical issues raised by the use a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- BIOLOGICAL IMPLICATIONS OF CRISPR-CAS9arrow_forwardelect molecular outcomes that can be achieved with the CRISPR-Cas9 system (Check all that apply.) Gene activation Gene repression Loss of gene function Creation of a targeted mutation within a gene Creation of many copies of a specific genearrow_forwardPros and Cons of CRISPR-CAS9 please explain it in a simple languagearrow_forward
- Can you select answers in each bracket? CRISPR-Cas9 is a system for directly changing the sequence of [ Select ] ["DNA", "RNA"] and is derived from bacterial systems designed to block infection by [ Select ] ["bacteriophage", "HIV"] . The original system contained two RNA molecules, crRNA and tracrRNA, that formed a complex that recruited Cas9 protein. Dr. Doudna and her colleague Dr. Emmanuelle Charpentier found they could make a single guide RNA (sgRNA) that had an [ Select ] ["intramolecular interaction (H-bonding)", "RNAse activity"] that could bind and activate Cas9 to form a break at the sequence targeted by the sgRNA. While the CRISPR-Cas9 system can direct scission of the target, any change in sequence is achieved by [ Select ] ["the cells endogenous repair system", "providing cells with DNA recombination proteins"] . Therefore, generating small deletions or insertions is technically [ Select ] ["more difficult", "more feasible"] than precise replacement of a specific…arrow_forwardWhy do researchers believe lncRNA is a promising field for developing drug therapies and CRISPR/Cas can be used to treat disease?arrow_forwardBriefly explain why RNA-seq gives more information about the transcriptome than does microarray analysis.arrow_forward
- Does one have a practical idea of the role of CRISPR/Cas9 in genome editing via cutting of DNA?arrow_forwardYou design a guide RNA to target your gene of interest, which you will express attached to a scaffold RNA. You transform cells with Cas9, the guide+scaffold RNA, and an HDR template. The HDR template codes for the insertion of a premature stop codon located 10 bp upstream of the Cas9 cut site, a base pair substitution 15 bp upstream of the Cas9 cut site, and a base pair substitution in the PAM sequence. Question: Is this scenario “possible” or “not possible”? Cas9 cuts the target site, the stop codon and the two base pair substitutions are introduced.arrow_forwardYou design a guide RNA to target your gene of interest, which you will express attached to a scaffold RNA. You transform cells with Cas9, the guide+scaffold RNA, and an HDR template. The HDR template codes for the insertion of a premature stop codon located 10 bp upstream of the Cas9 cut site, a base pair substitution 15 bp upstream of the Cas9 cut site, and a base pair substitution in the PAM sequence. Question: Is this scenario “possible” or “not possible”? Cas9 cuts the target gene sequence at a site 3 bp downstream of a PAM site Explain your reasoning as to why.arrow_forward
- Diagram the mechanism by which CRISPR-cas functions in the immune system of bacteria.arrow_forwardShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardPlease select appropriate word in each bracket CRISPR-Cas9 is a system for directly changing the sequence of [ Select ] ["DNA", "RNA"] and is derived from bacterial systems designed to block infection by [ Select ] ["bacteriophage", "HIV"] . The original system contained two RNA molecules, crRNA and tracrRNA, that formed a complex that recruited Cas9 protein. Dr. Doudna and her colleague Dr. Emmanuelle Charpentier found they could make a single guide RNA (sgRNA) that had an [ Select ] ["intramolecular interaction (H-bonding)", "RNAse activity"] that could bind and activate Cas9 to form a break at the sequence targeted by the sgRNA. While the CRISPR-Cas9 system can direct scission of the target, any change in sequence is achieved by [ Select ] ["the cells endogenous repair system", "providing cells with DNA recombination proteins"] . Therefore, generating small deletions or insertions is technically [ Select ] ["more difficult", "more feasible"] than precise replacement of a…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License