Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter ST.6, Problem 1DQ
There are nine known progressive neurodegenerative disorders that all share expanded numbers of the CAG codon, which inserts extra glutamine residues into the coding regions of specific genes. Genes carrying such mutations are typically gain-of-function mutations and often share a common mechanism of pathogenesis. Why would such genes be gain-of-function? Speculate on why such diseases may be caused by a common mechanism.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
There are nine known progressive neurodegenerative disorders that all share expanded numbers of the CAG codon, which inserts extra glutamine residues into the coding regions of specific genes. Genes carrying such mutations are typically gain-of-function mutations and often share a common mechanism of pathogenesis. Why would such genes be gain-of-function? Speculate on why such diseases may be caused by a common mechanism.
Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myleoid leukaemia?
A. t(8;21) translocaton (RUNX1_RUNX1fusion)
B. DNMT3A mutation
C. TP53 deletion
D. NPM1 mutation.
provide a list of 3 ways on how tyrosine kinase 2 gene associated with multiple sclerosis diseases.?
Chapter ST Solutions
Concepts of Genetics (12th Edition)
Ch. ST.1 - What is the difference between innate immunity and...Ch. ST.1 - What evidence demonstrates that CRISPR-Cas is an...Ch. ST.1 - Prob. 3RQCh. ST.1 - Why was the type II CRISPR-Cas9 system of S....Ch. ST.1 - Prob. 5RQCh. ST.1 - What is a single guide RNA, and what role does it...Ch. ST.1 - What is the difference between nonhomologous...Ch. ST.1 - Prob. 8RQCh. ST.1 - Prob. 9RQCh. ST.1 - Prob. 1DQ
Ch. ST.1 - Prob. 2DQCh. ST.1 - What ethical and safety considerations must be...Ch. ST.1 - Recall (from Chapter 18) how miRNAs and the...Ch. ST.1 - Describe two different ways in which engineered...Ch. ST.1 - Consider the following human genetic diseases:...Ch. ST.1 - What are the different concerns about off-target...Ch. ST.2 - What is VNTR profiling, and what are the...Ch. ST.2 - Prob. 2RQCh. ST.2 - Describe capillary electrophoresis. How does this...Ch. ST.2 - What are the advantages and limitations of...Ch. ST.2 - Prob. 5RQCh. ST.2 - Explain why mitochondrial DNA profiling is often...Ch. ST.2 - Prob. 7RQCh. ST.2 - Describe the database system known as CODIS. What...Ch. ST.2 - Prob. 9RQCh. ST.2 - Prob. 10RQCh. ST.2 - Given the possibility that synthetic DNA could be...Ch. ST.2 - Prob. 2DQCh. ST.2 - If you were acting as a defense lawyer in a murder...Ch. ST.2 - The phenomena of somatic mosaicism and chimerism...Ch. ST.3 - What is pharmacogenomics, and how does it differ...Ch. ST.3 - Describe how the drug Herceptin works. What types...Ch. ST.3 - Prob. 3RQCh. ST.3 - Prob. 4RQCh. ST.3 - Prob. 5RQCh. ST.3 - Prob. 6RQCh. ST.3 - Why is it necessary to examine gene-expression...Ch. ST.3 - Prob. 8RQCh. ST.3 - Prob. 1DQCh. ST.3 - Prob. 2DQCh. ST.3 - How can we ensure that a patients privacy is...Ch. ST.3 - As gene tests and genomic sequences become more...Ch. ST.4 - How do genetically modified organisms compare with...Ch. ST.4 - Prob. 2RQCh. ST.4 - Prob. 3RQCh. ST.4 - Prob. 4RQCh. ST.4 - Describe the mechanisms by which the Cry proteins...Ch. ST.4 - Prob. 6RQCh. ST.4 - Prob. 7RQCh. ST.4 - Describe how plants can be transformed using...Ch. ST.4 - How do positive and negative selection techniques...Ch. ST.4 - Prob. 10RQCh. ST.4 - What are the laws regulating the development,...Ch. ST.4 - Do you think that foods containing GM ingredients...Ch. ST.4 - Prob. 3DQCh. ST.5 - What is gene therapy?Ch. ST.5 - Prob. 2RQCh. ST.5 - When treating a person by gene therapy, is it...Ch. ST.5 - Describe two ways that therapeutic genes can be...Ch. ST.5 - Explain how viral vectors can be used for gene...Ch. ST.5 - Prob. 6RQCh. ST.5 - Explain an example of a successful gene therapy...Ch. ST.5 - Prob. 8RQCh. ST.5 - Prob. 9RQCh. ST.5 - Prob. 10RQCh. ST.5 - Prob. 11RQCh. ST.5 - Prob. 1DQCh. ST.5 - Who should be treated by gene therapy? What...Ch. ST.5 - The lifetime costs for treatment of conditions...Ch. ST.5 - Should CRISPR-Cas or other techniques be used for...Ch. ST.5 - Prob. 5DQCh. ST.6 - What are RFLP markers and how were they used to...Ch. ST.6 - Why was information from Nancy Wexlers large...Ch. ST.6 - How do aggregates of mHTT protein form?Ch. ST.6 - Why are the results from the inducible mouse model...Ch. ST.6 - Based on the results from mouse models, is it...Ch. ST.6 - What do the results from creating transgenic mice...Ch. ST.6 - What steps lead from the binding of the mHTT...Ch. ST.6 - Summarize the approaches to therapy designed to...Ch. ST.6 - There are nine known progressive neurodegenerative...Ch. ST.6 - Prob. 2DQCh. ST.6 - Prob. 3DQCh. ST.6 - Why is there an inverse correlation between the...Ch. ST.6 - Discuss the ethical issues raised by the use a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Muckle–Wells syndrome is an autosomal dominantly inherited disease due to mutations in NLRP3. Individuals with this disease suffer from episodes of fever, as well as urticarial rash, joint pains, and conjunctivitis. What is the explanation for the beneficial effects of anakinra (IL-1 receptor antagonist) treatment in these patients?arrow_forwardThere are three different chitin synthase genes that control the chitin synthesis in Saccharomyces cerevisiae, namely CHS I, CHSII, and CHSIII. If a mutation occurs in each of these genes, what will happen to the S. cerevisiae?arrow_forwardMutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxiaarrow_forward
- The small, monomeric protein Rho has acquired a mutation by which it is constitutively activated and evenly distributed along with the cytoplasmic leaflet of the plasma membrane. Describe the effects this would have on cell crawling. A complete answer will include a description of normal Rho distribution and activation, an explanation of Rho function in cell crawling, and a thoughtful argument for an overall effect of the mutation on cell crawling that is based on the specific roles of Rho.arrow_forwardHuntington disease (HD) is an inherited neurodegenerative disorder characterized by gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age, and the course of the disease can range from 15 to 20 years. The molecular basis of HD is becoming better understood, and the genetic mutation has been traced to a gene that encodes a large protein of unknown function. In individuals who will not develop HD, a region of the gene that encodes the N-terminus of this protein has a sequence of CAG codons (for glutamine) repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon (3 nucleotides) is typically repeated 40 to 55 times In those with childhood-onset HD, it is repeated more than 70 times. *codon: refers to the 3 nucleotides that code for amino acid. A small portion of the coding sequence of the HD gene is given below. The nucleotide sequence of the DNA is…arrow_forwardWhy do you think it has been so difficult to identify genes underlying schizophrenia? Rachel asked to see a genetic counselor because she was concerned about developing schizophrenia. Her mother and maternal grandmother both had schizophrenia and were institutionalized for most of their adult lives. Rachels three maternal aunts are all in their 60s and have not shown any signs of this disease. Rachels father is alive and healthy, and his family history does not suggest any behavioral or genetic conditions. The genetic counselor discussed the multifactorial nature of schizophrenia and explained that many candidate genes have been identified that may be mutated in individuals with the condition. However, a genetic test is not available for presymptomatic testing. The counselor explained that based on Rachels family history and her relatedness to individuals who have schizophrenia, her risk of developing it is approximately 13%. If an altered gene is in the family and her mother carries the gene, Rachel has a 50% chance of inheriting it.arrow_forward
- Corticosteroids are powerful anti-inflammatory drugs that alter the transcription of many genes. Corticosteroids are anti-inflammatory drugs that are used to treat individuals with allergies, asthma, autoimmune diseases, or organ transplants. These compounds have a wide range of effects on leukocytes and on inflammatory cytokine production. One common use for corticosteroids is as an inhaled treatment for individuals with asthma. Interestingly, inhaled corticosteroids provide significant benefit to asthma patients with high numbers of eosinophils in their airways, but not to those patients with high numbers of neutrophils, but normal numbers of eosinophils. One reason for this finding may be that: Corticosteroids don’t inhibit IL-13 production in the airways Corticosteroids don’t inhibit release of IL-33 by airway epithelial cells Corticosteroids induce apoptosis of Treg cells Corticosteroids induce apoptosis of eosinophils Corticosteroids don’t work well as combination therapy with…arrow_forwardFor the following diseases, describe the best technique for diagnosing them. Please make sure you include how you would tell someone with the disease from someone without the disease. B. Factor V Leiden thrombophilia is caused by a point mutation at position 1691 in exon 10 of the Factor V clotting factor gene that changes an arginine into a glutamine. This change removes one of the cleavage sites for activated protein C and leads to an increased tendency to clot.arrow_forwardWhat is the relationship between beta-amyloid and the protein APP? How does the APP protein differ in a person with the Alzheimer's-risk version of this gene compared to the neurotypical populations?arrow_forward
- To what extent is there an ethical difference between PAS and AVE?arrow_forwardIn some inherited cases, the normal prion protein can convert spontaneously to the abnormal form, but at a slow rate. True or Falsearrow_forwardNeurofibromatosis type 1 (NF1) is an inherited is an inheritent dominant disorder. The phenotype usually involves the production of many skin neurofibromas. Answer the following questions about the disorder: a) Are the NF1 neurofibromatosis-causing mutations that are inherited by affected children from affected parents likely to be loss-of-function or gain-of-function mutations? b) Neurofibromin, the protein product of NF1, is associated with the Ras protein. Ras is involved in the transduction of extracellular signals from growth factors. The active form of Ras is complexed with GTP; the inactive form is complexed with GDP. Would the wild-type neurofibromin protein favor the formation of Ras-GTP or Ras-GDP? c) Which of the following events in a normal cell from an individual inheriting a neurofibromatosis-causing allele could cause the descendents of that cell to turn into a neurofibroma? i. A second point mutation in…arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Nervous System - Get to know our nervous system a bit closer, how does it works? | Neurology; Author: FreeMedEducation;https://www.youtube.com/watch?v=6O-0CVAgaEM;License: Standard youtube license