Copy of INFO 4 Mutation analysis problem KEY

RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…

Topic is central dogma of molecular biology   Question: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a phenotype. Please explain it to me thank you

pls help me to complete these problem

Question in Image. Thank you!

practice problem genetics

Practice test

Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.

Please do all parts. Thank you

**not sure if you needed the second picture** Please complete number one. Explain how to figure it out. Thank you so much!

Explain translation more depth please im really confused

Please hand written not allowed.

6c and 6d

Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed by condensation between the -NH2 function of the first amino acid (AA N° 1) and the -COOH function of the second amino acid (AA N° 2). C- Is generated by the ribosome during the process of transcription. D- Is an amino function. E- All possibilities given above are wrong.

Instructions Using the Concord Consortium interactive, observe how mutations can affect protein formation and function. From your observations of the interactive, summarize your observations of how each change in DNA affects the protein that is made. Screenshots will be required for your assignment. Interpret and analyse your results: identify the type of mutation, and describe and explain the effect of each change on protein size, shape and polarity. Create two different mutation types and observe the different outcomes.

Please help asap encoded text form please not handwritten thank you

Remember remove the introns! All introns start with GT and end with AG.

Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…

Part II: Information Transfer Background Information - Key Points The background information provided for this lab has given you a general overview of some of 24 the key terms and definitions necessary to understand the transfer of information from gene to protein. The information included below will help you work through the specific problems included in your Tutorial 4 Assignment. When working on the problems remember the base mu to pairing rules (Table 3). Table 3: Rules for nucleotide base pairing. cytosine (C) - guanine (G) adenine (A)- thymine (T) DNA RNA For Transcription: ● ● ● ● cytosine (C) - guanine (G) adenine (A)- uracil (U) Initiation is determined by the recognition of the promoter sequence in the DNA by the RNA polymerase. Stef The transcription start site is downstream of the promoter and is designated as the +1 site. Aspartic acid Alanina Valine Arginine Serine Lysine Asparagine Glutamic TEOPO|0C|AGUCAG|UC|AG/DCAG/3G/ CAGUC UGU A C A Threonine G Methionine Isoleucine…

I need parts d, e and f solved please

This answer is incorrect pls provide the right answer and explanation

FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5' UTR Exon Intron Exon Intron Exon 3' UTR MRNA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a 5'UTR-EXONS-INTRONS 3'UTR 5'UTR-EXONS-3'UTR 5'UTR-INTRONS-3'UTR P. EXONS a Save Unanswered 59 What is b? 3'

Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)

Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)

Questions and situational problems I. A particular gene codes for a mature mRNA containing 900 bases, which is translated into a 40 kDa protein. A mutant form of the gene created by a single point mutation yields an 830-base mature mRNA yielding a 37 kDa protein with modified enzymatic activity. The analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.

can you help me this answer properly just fllow the instructions and can you explain each of the problem

6. What codons ar e found in the mRNA for the two mutated DNA?

1

question in image, thank you!

Question Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Leu O The normal amino acid sequence of a protein is Met-Ala-Phe Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Tyr O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-STOP Moire to the net question prevents changes to this angN

Question:- What is the role of tRNA? To replace T with U when transcribing mRNA. To bind the ribosome and the mRNA chain together. To transcribe the DNA and move the mRNA chain out of the nucleus. To assure that the mRNA chain carries the correct code. To carry the correct amino acids to the ribosome.

Complete the following problems.  1. Draw a molecule of phosphatidyl serine using palmitic acid and linoleic (Δ9,12) acid 2. Consider the following coding strand sequence of DNA to a corresponding amino acid sequence. This represents the first amino acids to be translated. Underline the codon where translation will be initiated, and give the amino acid sequence of the peptide produced.                5’-CGATGCTCAAGTTTC-3’ 3. Within the matrix of the mitochondria, the pH is approximately 6.8 ([H+] = 1.6 X 10-7), while it is 7.4 ([H+] = 4.0 X 10-8) in the intermembrane space outside the matrix. Calculate the free energy driving transport of hydrogen ions from the intermembrane space to the matrix. Remember to include both the concentration and the membrane potential factors. 4. Draw the adenosine-5’-diphosphate.