Genetic expression involves transcription and translation. Match the structure or molecule to the step. a. promoter region b. RNA polymerase c. antisense strand d. poly-A tail е. 5 саp f. splicing g. anticodon loop h. acceptor stem i. peptide bond j. A site 57. transcribed strand that will go on to translation 58. site where TRNA with amino acid enters the ribosome 59. intron sequences are removed and exons are combined together 60. site where amino acid combines with tRNA

Q: Which of the following events would NOT result in ribosomes stalling on an MRNA during translation?…

A: A release factor is a protein that recognizes a stop codon in an mRNA sequence and causes…

Q: 1 2 3 4 5 6 7 8 9 10 11 Translocation                       RNA polymerase binds in the promoter…

A: transcription is the process of formation of mRNA from the DNA sequence  Translation is the process…

Q: What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)?…

A: EF-Tu is a highly conserved elongation factor in prokaryotes. It catalyzes the binding of tRNA…

Q: Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical…

A: Introduction 1. Hydrogen bonds are a type of attractive interaction between an electronegative atom…

Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…

A: There are different types of mutations, that result in a change or no change in the protein…

Q: Provide the correct sequence of steps in each process described below. Write the letters in series…

A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…

Q: During elongation, TRNA binds initially to the A "P" site on the ribosome. B any available site on…

A: tRNA also called the transfer RNA and is an adaptor molecule. tRNA molecule at as a link between…

Q: The “A” site in the ribosome refers to the:     A. binding site for charged t-RNA molecules…

A: According to the question, we have to find out the function of the "A" site in the ribosome from the…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Mutation of which of these sequences would have an effect on translational initiation?   A. 3’ UTR…

A: Introduction  Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…

A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…

Q: In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These…

A: Codon is located on mRNA while anticodon is on tRNA. Anticodons specifically identifies and pair to…

Q: which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes?   A. The…

A: The Shine–Dalgarno sequence is a ribosomal binding site in prokaryotic mRNA, generally located…

Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…

A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…

A: Inside the nucleus of the cell , DNA act as a  template for the manufacturing of single strand of…

Q: 1. Which of the following has only one equivalent codon? A) Ala B) Arg C) Val D) Trp E) Gly

A: Since you have asked multiple question, we will solve the first question for you. If you  want any…

Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…

A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: Sequence the following steps in protein synthesis from first to last (1-6) ___A. Transciptions…

A: TRANSLATION is the process by which a protein is synthesized from the information contained in a…

Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…

A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…

Q: Choose the correct function of tRNA. O A, TRNAS are an intermediate stage of RNA processing where…

A: INTRODUCTION tRNA tRNA is transfer RNA molecule that can decode the mRNA and helps in the production…

Q: During translation, ____________ is the step in which new t-RNA is attracted to the ribosome (a)…

A: Translation is the process in which proteins are synthesized by ribosomes. Translation occurs after…

Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…

A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…

Q: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming…

A: Hello! According to guidelines we have to answer the first 3 sub-parts only. so please kingly post…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…

A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…

Q: the chemical group responsible for nucleophilic attack in translational elongation is  a) free…

A: Translation:        It involves decoding a messenger (mRNA) and using it's information to build a…

Q: Students are modeling mRNA during the process of protein synthesis. Which answer choice correctly…

A: DNA replication is defined as a type of biological process where the DNA of the organism replicates…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: c. In transcription, the information in the DNA of every cell is converted into small, portable RNA…

A: The DNA is transcribed into mRNA by RNA polymerase and then this mRNA is translated into polypeptide…

Q: The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the…

A: Introduction Transcription takes place in the nucleus, During transcription, It uses DNA as a…

Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…

A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…

Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…

A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices.  in…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which…

A: According to the central dogma of life, DNA replicates to form copies of itself. DNA acts as a…

Q: A. Taq polymerase B. Release factors C. Reverse transcriptase D. CDNA 1. Catalyzes peptide bond…

A: 1.  H peptidyl transferase  2.  G aminoacyl  tRNA synthetase 3.  K  shine dalgarno sequence 4. I…

Q: Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? *   A.…

A: The RNA molecule is made up of four nucleotide bases: adenine (A), cytosine (C), guanine (G), and…

Q: In a study of  several families for differences in the sequence of a particular gene suspected to…

A: The mutation is the change in the nucleic acid sequence that alters the way the particular gene gets…

Q: 5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA  (b) tRNA…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…

Q: a) What is a mutation in molecular terms?      b) a mutation deletes a base in the genomic DNA…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: When would a ribosome bind to a promoter sequence? A) It wouldn't. A promoter is a DNA sequence, and…

A: Ribosomes bind to mRNA during the process of translation. Initiation of protein synthesis involves…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.