You obtain the sequence of a gene containing 10 exons, 9 introns, and a 3_ UTR containing a polyadenylation consensus sequence. The fifth intron also contains a polyadenylation site. To test whether both polyadenylation sites are used, you isolate mRNA and find a longer transcript from muscle tissue and a shorter mRNA transcript from all other tissues. Speculate about the mechanism involved in the production of these two transcripts. Please answer the concept elaborately.

You obtain the sequence of a gene containing 10 exons, 9 introns, and a 3_ UTR containing a polyadenylation consensus sequence. The fifth intron also contains a polyadenylation site. To test whether both polyadenylation sites are used, you isolate mRNA and find a longer transcript from muscle tissue and a shorter mRNA transcript from all other tissues. Speculate about the mechanism involved in the production of these two transcripts. Please answer the concept elaborately.

Name: You obtain the sequence of a gene containing 10 exons, 9 introns, and
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You obtain the sequence of a gene containing 10 exons, 9 introns, and a 3_ UTR containing a polyadenylation consensus sequence. The fifth intron also contains a polyadenylation site. To test whether both polyadenylation sites are used, you isolate mR

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
When a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?
While characterizing a mutation in a gene of interest, you discover that the mutation involves an insertion within the coding sequence of the gene. You suspect that the inserted sequence is a transposon and would like to determine which of the three major transposon families it belongs to. What sequence elements could be looked for within the inserted sequence that would help place it in one of the three families?
The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?
Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter, exon, or intron of the gene? Explain your answer.
Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that encodes a protein 100 amino acids long. Is it more likely that the protein produced by this mutant allele will be shorter or longer than 100 amino acids long?
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
If a gene sequence has two poly-A sites, one in the center and one at the end, we can isolate mRNA with a longer and shorter transcript if both polyadenylation sites are exploited. What mechanism is responsible for the generation of these two transcripts?