Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 20P
In the human immune system, so-called B cells can make more than a billion different types of antibody molecules that protect us from infection. However, our genomes have only three genes that encode the polypeptides found in antibodies. What experiments could you perform to determine what kind of combinatorial events occur at the DNA level (V-D-J joining) and RNA level (alternative splicing) for any of these genes?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
According to the scenario shown, how many segments of DNA (one, two, or three) are removed during site-specific recombination within the gene that encodes the κ (kappa) light chain for IgG proteins? How many segments are spliced out of the pre-mRNA?
Why do promoter mutations cluster at positions −10and −35 as shown in Figure 11-11? Which protein-DNAinteraction is disrupted by these mutations?
Often geneticists look for suppressors to find interactive proteins. Which of the type(s) of suppressors you put for part a will help to identify interacting proteins, and which type(s) will not? What are two (or one, if we don’t get a chance to talk about two of them in class) other techniques (not necessarily “genetic” techniques, but at least, lab techniques) that help to identify identifying proteins?
Chapter 10 Solutions
Genetics: From Genes to Genomes
Ch. 10 - Prob. 1PCh. 10 - List three independent techniques you could use to...Ch. 10 - Figure 10.2a has numbers indicating the...Ch. 10 - Which of the enzymes from the following list would...Ch. 10 - Prob. 5PCh. 10 - a. What sequence information about a gene is...Ch. 10 - Why do geneticists studying eukaryotic organisms...Ch. 10 - Consider three different kinds of human libraries:...Ch. 10 - The human genome has been sequenced, but we still...Ch. 10 - This problem investigates issues encountered in...
Ch. 10 - For the sake of simplicity, Fig. 10.4 omitted one...Ch. 10 - Give two different reasons for the much higher...Ch. 10 - Using a cDNA library, you isolated two different...Ch. 10 - The figure that follows shows part of a modified...Ch. 10 - In Problem 14, cDNAs F and G could not be found in...Ch. 10 - Fig. 10.10 presents a model for exon shuffling in...Ch. 10 - An interesting phenomenon found in vertebrate DNA...Ch. 10 - a. If you found a zinc-finger domain which...Ch. 10 - Prob. 19PCh. 10 - In the human immune system, so-called B cells can...Ch. 10 - Chimpanzees have a set of hemoglobin genes very...Ch. 10 - Complete genome sequences indicate that the human...Ch. 10 - On your computers browser, view the page accessed...Ch. 10 - Prob. 24PCh. 10 - Prob. 25PCh. 10 - Certain individuals with mild forms of...Ch. 10 - The 1 and 2 genes in humans are identical in their...Ch. 10 - Prob. 28P
Additional Science Textbook Solutions
Find more solutions based on key concepts
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
Human Anatomy
Why is it unlikely that two neighboring water molecules would be arranged like this?
Campbell Biology (10th Edition)
6. How can you use the features found in each chapter?
Human Anatomy & Physiology (2nd Edition)
Review the Chapter Concepts list on page 422. These all center on quantitative inheritance and the study and an...
Essentials of Genetics (9th Edition) - Standalone book
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
Explain why hyperthermophiles do not cause disease in humans.
Microbiology with Diseases by Taxonomy (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the bacteriophage T7 system used to express recombinant proteins, the gene of interest is fused to T7 promoter and T7 RNA polymerase is separately cloned into the same cell. What is the main reason this system uses T7 RNA polymerase instead of relying on the bacterial RNA polymerase? To restrict the expression of bacterial protein expression To enhance the amount of recombinant protein expression To enhance the expression of bacterial protein expression To restrict the amount of recombinant protein expression To enable the expression of T7 viral protein expressionarrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardWhat is the first step in quantifying the relative amounts of mRNA in different tissues? Would this method be useful in determining which immune system genes might be over-expressed in severe Covid cases? Why or why not? Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in…arrow_forward
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forwardHow do I draw the sequence and explain the process for each step? Draw the sequence of molecular events that occurs to induce STAT transcription factor localization to the nucleus. To complete this, you will draw the first step that occurs, then draw a new figure with the second step that occurs, then draw a new figure with the third step that occurs, and so on until you have completed all of the steps. On the drawing, briefly label each molecular event (each drawing). For this brief label, explain what is happening during each step.arrow_forwardConsider a single base insertion mutation between the 3rd and 4th codons in a natural gene that encodes a protein 100 amino acids long. Is it more likely that the protein produced by this mutant allele will be shorter or longer than 100 amino acids long?arrow_forward
- The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen genearrow_forwardIf the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forwardThe recombination signal sequences of human V,D,J and C immunoglobulin genes resemble which sequences on the ends of transposons?arrow_forward
- A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forwardWhat is the function of RAG1? What will happen if RAG1's function is lost due to mutations?arrow_forwardWhat do TATA boxes, initiators, and CpG islands have in common? Which was the first of these to be identified? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License