Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 23P
On your computer’s browser, view the page accessed by the URL: http://genome.ucsc.edu/cgi-bin/hgGateway
In the Search Term box at the top, type CFTR (for the CFTR gene responsible for cystic fibrosis), then hit “GO.” You will be directed to a window showing the organization of the CFTR gene on human chromosome 7. (If a list appears instead of a picture, click on the first link at the top of the list, and you will be directed to the proper window.) At the top of this window are control buttons that allow you to move your view to the left or right, zoom in (even to the level of the
| a. | How many exons are in the CFTR gene? |
| b. | Is the CFTR gene located on the short arm (the p arm) or the long arm (the q arm) of human chromosome 7? |
| c. | In which direction is the CFTR gene transcribed: toward the centromere, or away from the centromere? Section 10.4 Now zoom out the view by 10× |
| d. | What are the names of the genes that flank CFTR on either side? Are these genes transcribed from the same strand of chromosome 7 as CFTR, or from the other strand? Now zoom out 100× until the entirety of chromosome 7 is visible. |
| e. | What is the approximate size of chromosome 7 in Mb? |
| f. | What is the approximate location of the centromere on human chromosome 7? |
| g. | What is the significance of the RefSeq genes’ appearing to pile up when you are viewing the whole chromosome? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If you had the ability to do gene editing with ONE gene for the betterment of human kind, which one would you choose, and why? Assume you could either change an abnormal allele associated with a disease, such as the cystin gene associated with Cystic Fibrosis to its normal wild type, or add a pre-existing human allele to a genome.
Using a laser beam, you isolated several R bands from human chromosomes. Answer the following questions
What kinds of genes are present in R bands?
Which isochors do you expect to be present in the R band?
What class of interspersed repeats will be present in R bands?
What class of tandem repeats do you expect to find in RG bands?
Would you expect to find telomere sequences in some R bands?
Below is a sample of a segment of DNA…(copy from left to right)
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’
5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’
1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation.
2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation.
3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning.
4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids).
5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Chapter 10 Solutions
Genetics: From Genes to Genomes
Ch. 10 - Prob. 1PCh. 10 - List three independent techniques you could use to...Ch. 10 - Figure 10.2a has numbers indicating the...Ch. 10 - Which of the enzymes from the following list would...Ch. 10 - Prob. 5PCh. 10 - a. What sequence information about a gene is...Ch. 10 - Why do geneticists studying eukaryotic organisms...Ch. 10 - Consider three different kinds of human libraries:...Ch. 10 - The human genome has been sequenced, but we still...Ch. 10 - This problem investigates issues encountered in...
Ch. 10 - For the sake of simplicity, Fig. 10.4 omitted one...Ch. 10 - Give two different reasons for the much higher...Ch. 10 - Using a cDNA library, you isolated two different...Ch. 10 - The figure that follows shows part of a modified...Ch. 10 - In Problem 14, cDNAs F and G could not be found in...Ch. 10 - Fig. 10.10 presents a model for exon shuffling in...Ch. 10 - An interesting phenomenon found in vertebrate DNA...Ch. 10 - a. If you found a zinc-finger domain which...Ch. 10 - Prob. 19PCh. 10 - In the human immune system, so-called B cells can...Ch. 10 - Chimpanzees have a set of hemoglobin genes very...Ch. 10 - Complete genome sequences indicate that the human...Ch. 10 - On your computers browser, view the page accessed...Ch. 10 - Prob. 24PCh. 10 - Prob. 25PCh. 10 - Certain individuals with mild forms of...Ch. 10 - The 1 and 2 genes in humans are identical in their...Ch. 10 - Prob. 28P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardPlease use information from the text below and your knowledge of biology to answer the final two (2) questions. In 2003, as a result of the Human Genome Project, the complete sequence of all the bases in human DNA was released to the public. Although knowing the entire sequence of bases has proven valuable, scientists are currently working to map genes. Mapping genes involves determining the exact location of each gene. Since much of human DNA does not code for a protein, it is challenging to figure out which segments are actual genes. Often, scientists look at the percent composition of bases in a segment of DNA. If the segment of DNA has a large percentage of C and G bases (together over 50%), it is likely that it is a gene and codes for a protein. 10. Is it likely this segment of DNA codes for a protein? State 'yes' or 'no' AND support your answer using information from the text.arrow_forwardPlease use information from the text below and your knowledge of biology to answer the final two (2) questions. In 2003, as a result of the Human Genome Project, the complete sequence of all the bases in human DNA was released to the public. Although knowing the entire sequence of bases has proven valuable, scientists are currently working to map genes. Mapping genes involves determining the exact location of each gene. Since much of human DNA does not code for a protein, it is challenging to figure out which segments are actual genes. Often, scientists look at the percent composition of bases in a segment of DNA. If the segment of DNA has a large percentage of C and G bases (together over 50%), it is likely that it is a gene and codes for a protein. 9. A scientist analyzed the bases in a segment of DNA from a human skin cell to determine if it codes for a protein. The base A (Adenine) is 11% of the bases in this segment of DNA. Calculate the percentage of bases that would be C…arrow_forward
- The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.arrow_forwardA method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…arrow_forwardIn Figure 5-38, precisely which gene is eventually identified from the genome sequence?arrow_forward
- In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.arrow_forwardBased from Fig. 1B, which of the following lanes contain a good quality genomic DNA? Bad quality genomic DNA? Why or Why not? Answer in maximum of 5 sentences only. You can prove your answer by describing the banding pattern of each lanes and how to troubleshoot the DNA extraction procedure if possible.arrow_forwardIn Figure , what do the red and blue parts of the DNA labeled by balloon 6 represent?arrow_forward
- The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…arrow_forwardThe human genome is approximately 3 billion basepairs in size.a. Using standard 8.5″ × 11″ paper with one-inch margins, a 12-point font size, and single-spaced lines, howmany sheets of paper printed on one side would berequired to print out the human genome?b. A ream of 500 sheets of paper is about 5 cm thick.How tall would the stack of paper with the entirehuman genome be?c. Would you want a backpack, shopping cart, or asemitrailer truck to haul around this stack?arrow_forwardPlease draw a diagram to show the genomic organization of a gene with three exonsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY