a. To determine: The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions. Introduction: The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Question

Want to see the full answer?

Answer 1

Question

Chapter 10, Problem 24P

Summary Introduction

a.

To determine:

The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions.

Introduction:

The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Summary Introduction

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

Summary Introduction

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?

Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?

In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’

Answer 2

Question

Chapter 10, Problem 24P

Summary Introduction

a.

To determine:

The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions.

Introduction:

The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Summary Introduction

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

Summary Introduction

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 10, Problem 24P

Summary Introduction

a.

To determine:

The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions.

Introduction:

The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Summary Introduction

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

Summary Introduction

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 10, Problem 24P

Summary Introduction

a.

To determine:

The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions.

Introduction:

The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Summary Introduction

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

Summary Introduction

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 10, Problem 24P

Summary Introduction

a.

To determine:

The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions.

Introduction:

The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Summary Introduction

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

Summary Introduction

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Answer 6

Chapter 10, Problem 24P

Summary Introduction

a.

To determine:

The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions.

Introduction:

The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Answer 7

Chapter 10, Problem 24P

Summary Introduction

a.

To determine:

The human gene that best matches the query sequence and observes only at the first entry, which corresponds to the first entry under the descriptions.

Introduction:

The genome is the complete DNA set present in the organism. BLAST is a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Answer 8

Summary Introduction

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

Answer 9

Summary Introduction

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

Answer 10

Summary Introduction

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Answer 11

Summary Introduction

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Answer 12

Expert Solution & Answer

Answer 13

Expert Solution & Answer

Answer 14

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 15

Ch. 10 - Prob. 1P Ch. 10 - List three independent techniques you could use to...Ch. 10 - Figure 10.2a has numbers indicating the...Ch. 10 - Which of the enzymes from the following list would...Ch. 10 - Prob. 5P Ch. 10 - a. What sequence information about a gene is...Ch. 10 - Why do geneticists studying eukaryotic organisms...Ch. 10 - Consider three different kinds of human libraries:...Ch. 10 - The human genome has been sequenced, but we still...Ch. 10 - This problem investigates issues encountered in...

Solution Summary: The author describes BLAST as a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Concept explainers

Videos

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Want to see the full answer?

Chapter 10 Solutions

Solution Summary: The author describes BLAST as a bioinformatic tool used in the analysis of data obtained from DNA sequencing.

Concept explainers

Videos

b. To determine: The exact match and to choose “mouse genomic + transcript” as the database to search. Introduction: The match between the sequence of two different organisms shows the evolutionary relationships between them.

c. To determine: The gene conserved in the mouse and the way in which it is conserved. Introduction: The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.

Want to see the full answer?

Chapter 10 Solutions

b.

To determine:

The exact match and to choose “mouse genomic + transcript” as the database to search.

Introduction:

The match between the sequence of two different organisms shows the evolutionary relationships between them.

c.

To determine:

The gene conserved in the mouse and the way in which it is conserved.

Introduction:

The gene which is same throughout evolution are the conserved genes. The conserved gene is unique.