GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 24CONQ
The initiation phase of eukaryotic transcription via RNA polymerase II is considered an assembly and disassembly process. Which types of biochemical interactions-hydrogen bonding, ionic bonding, covalent bonding, and/or hydrophobic interactions-would you expect to drive the assembly and disassembly process? How would temperature and salt concentration affect assembly and disassembly?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the production of RNA called and what is the enzyme that catalyzes the process?What are the similarities and differences between the transcription process and the repli-cation processes?Concerning their biological function what is the difference between DNA and RNA? Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?What is the difference between plasma membrane and cell wall?
Transcription in eukaryotes requires which of the following in addition to RNA polymerase? Choose all that apply
A) ribsomes and tRNAs
B) start and stop codons
C) several transcription factors
D) DNA nucleotides
E) Aminoacyl-tRNA synthetase
F) RNA nucleotides
.
Using the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines.
You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely:
1.) Result in an alteration to the mRNA sequence.
2.)Have no effect on transcription or the mRNA sequence
3.)Prevent transcription at the TATAA box
4.) Result in an increase or decrease in the amount of mRNA transcribed
Chapter 12 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 12.1 - 1. Which of the following base sequences is used...Ch. 12.1 - Prob. 2COMQCh. 12.2 - With regard to a promoter, a transcriptional start...Ch. 12.2 - Prob. 2COMQCh. 12.2 - 3. Sigma factor is needed during which stage(s) of...Ch. 12.2 - A uracil-rich sequence occurs at the end of the...Ch. 12.3 - Which RNA polymerase in eukaryotes is responsible...Ch. 12.3 - Prob. 2COMQCh. 12.3 - Prob. 3COMQCh. 12.3 - Prob. 4COMQ
Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Microbiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling possible in bacteria? Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?arrow_forward1.) Define transcription and translation. How does transcription and translation differ in prokaryotes vs. eukaryotes (i.e. What is present in one but not the other)? 2.) What it means when we say that genetic code is redundant? 3.) Describe the stages of transcription (in detail for each step) - what components are required? 4.) Describe the stages of translation in eukaryotes (initiation, elongation, termination)arrow_forwardExplain what is meant by the coupling of transcription and translation in bacteria. Does coupling occur in bacterial and/or eukaryotic cells? Explain.arrow_forward
- Transfer RNA in eukaryotic cells is synthesized by which of the following enzymes (sensitive to high concentrations of the fungal poison a-amanitin, but not to low concentrations)? RNA polymerase I DNA polymerase I RNA polymerase II DNA polymerase II RNA polymerase III Which of the following processes of genetic information flow can occur under laboratory conditions, but has never been observed to occur under natural conditions (either in living cells or in viruses)? transcription of RNA from a DNA template (using DNA-dependent-RNA-polymerase) self-replication of RNA from an RNA template (using RNA-dependent-RNA-polymerase) direct-translation of protein from a DNA template (using special ribosomes) self-replication of DNA from a DNA template (using DNA-dependent-DNA-polymerase) translation of protein from an RNA template (using ordinary ribosomes)arrow_forwardWhat are the specific steps of eukaryotic transcription? Be sure in your discussion that you include the following terms: template strand, non-template strand, initiation, elongation, termination, promoter region, RNA polymerase, termination signal.arrow_forwardDuring eukaryote transcription initiation, when TFIIE, TFIIA, TFIIB, TFIIF, and RNA pol II all join on the DNA strand, how do they know where to be put on the strand?arrow_forward
- In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the mature mRNA are involved (2 components) and b) what proteins are involved (at least 2 proteins)?arrow_forwardThe following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.arrow_forwarda) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forward
- This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1) 1)Which strand is the template strand for transcription? a)top b) bottom 2)What elements allowed you to identify the template strand? (Select all that apply) a)An ATG toward the 5' end ("upstream"} from the TSS b)The template strand has the 3' end on the left side. c) An ATG toward the 3' ("downstream") from the TSS d) The template strand is "read" by the polymerase from its 3' to 5' end. 3)What is the sequence of the mRNA transcribed from this gene? a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’ b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’ c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’ d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’ 4) Write the…arrow_forwardI'm studying Transcription in bacteria, my textbook writes that: "the holoenzyme “explores” a length of DNA until it encounters a promoter region and binds there to about 60 nucleotide pairs along the double helix, 40 of which are upstream from the point of initial transcription. Once this occurs, the helix is denatured, or unwound, locally, making the template strand of the DNA accessible to the enzyme." my question is what proteins or factors unwind the helix?arrow_forwardThe ribosome is the target for many important antibiotics. Distinct antibiotics inhibit various steps in the translation process. Please specify which step of the translation (one short sentence is sufficient) each antibiotic below targets (ex: kasugamycin – inhibits formation of the initiation complex) a) chloramphenicol b) tetracycline c) erythromycin d) aminoglycosides such as kanamycinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY