Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13, Problem 14QP
Summary Introduction
To describe: The type of vector used in the preparation of a cloned genomic library from human tissue culture cell line.
Introduction: In the manufacturing of human genomic library, the fragments of DNA used in the process can vary in size which can be picked up by the plasmid easily. About 8 million plasmids are required to include all the genetic information from an individual cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which BLAST program should we use in this case? (HINT, what type of sequence are you provided with?)
Question:-
What is genetic engineering? What organisms can it be performed on? Please give an example of at least one successful genetic engineering project.
Where was CRISPR/Cas9 initially found? What was its purpose in that organism?
What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.
Chapter 13 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 13.5 - Do you think the way this issue was handled should...Ch. 13.5 - Prob. 2EGCh. 13.7 - If you were offered the chance to have the genome...Ch. 13.7 - Prob. 2EGCh. 13 - Improving the nutritional value of food has long...Ch. 13 - Improving the nutritional value of food has long...Ch. 13 - Prob. 3CSCh. 13 - What Are Clones? Cloning is a general term used...Ch. 13 - Prob. 2QPCh. 13 - Prob. 3QP
Ch. 13 - Prob. 4QPCh. 13 - Prob. 5QPCh. 13 - Prob. 6QPCh. 13 - Cloning Genes Is a Multistep Process The following...Ch. 13 - Prob. 8QPCh. 13 - Prob. 9QPCh. 13 - Cloning Genes Is a Multistep Process Which enzyme...Ch. 13 - Cloning Genes Is a Multistep Process In cloning...Ch. 13 - Prob. 12QPCh. 13 - Prob. 13QPCh. 13 - Prob. 14QPCh. 13 - Prob. 15QPCh. 13 - Cloned Libraries You are running a PCR to generate...Ch. 13 - Prob. 17QPCh. 13 - Prob. 18QPCh. 13 - Prob. 19QPCh. 13 - Analyzing Cloned Sequences A base change (A to T)...Ch. 13 - Prob. 21QPCh. 13 - Analyzing Cloned Sequences What kind of...Ch. 13 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is NGS advantageous over Sanger based sequencing?arrow_forwardWhole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?arrow_forwardCloned Libraries You are running a PCR to generate copies of a fragment of the cystic fibrosis (CF) gene. Beginning with two copies at the start, how much of an amplification of this fragment will be present after six cycles in the PCR machine?arrow_forward
- Task A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from different samples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 cancerous samples, and 1 negative control. To make things easier in the lab, when running multiple reactions, the components are prepared not individually, but as a master mix—all the components for multiple reactions are prepared in bulk, except for the template DNA, which is added separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of these components, and the needed working concentrations for the PCR itself. Complete the table by supplying the needed volumes of each component for a single reaction and for the master mix (the first row has been filled in as an example).arrow_forwardTALENs What is it? And how it works in genome editing? Including additional figures pls At least 1-2 pagearrow_forwardClone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*arrow_forward
- Both microarray and RNA-sequencing can study the transcriptomes. Compare microarray and RNA sequencing technique in analyzing gene with high, medium and low copy number of genes.arrow_forward"Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?arrow_forwardQuestion:- When completing genome sequences, contiguous sequences, or contigs are important intermediates. Which of the following is true about contigs? Group of answer choices The smaller the contig, the better it is for a complete genome assembly. A contig represents the sequence production from a single sequencing reaction. A contig is the name for a fragment of DNA made from a larger genomic DNA or chromosome, prior to its sequencing. A contig represents a DNA sequence assembled from smaller sequencing reads, and has no gaps.arrow_forward
- Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGarrow_forwardWhy the DNA sequencing alone is often not sufficient to produce a genome assembly of desired reference-grade quality, particularly in eukaryotic organisms?arrow_forwardRecall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License