Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13, Problem 15QP
Summary Introduction
Introduction: A process of molecular biology which is responsible for the production of various copies of a particular segment of DNA is called “polymerase chain reaction (PCR).” Using the technique of PCR, a single segment of DNA can be amplified to produce sufficient number of copies of that particular segment.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
CHOICES:
a. Plasmid
b. Sticky end
c. DNA ligase
d. Transformation
e. Restriction enzyme
f. Genetic marker
g. Transduction
QUESTIONS:
Cuts the DNA into fragments
Circular DNA molecule of bacteria
Used to insert DNA of interest to vector
Area of DNA where bases are ready to be paired
Recombinant DNA technology with the help of a vector gene
The other options are:
a. RNA cannot be digested by restriction enzymes
b. RNA is small enough to be resolved on an agarose gel without the need for restriction digestion.
c. RNA is single stranded and DNA is double stranded
PCR is quick, efficient and easy to perform. However, there are some situations when cell-based cloning is preferred over PCR to amplify a DNA sequence. Mention two of them.
Chapter 13 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 13.5 - Do you think the way this issue was handled should...Ch. 13.5 - Prob. 2EGCh. 13.7 - If you were offered the chance to have the genome...Ch. 13.7 - Prob. 2EGCh. 13 - Improving the nutritional value of food has long...Ch. 13 - Improving the nutritional value of food has long...Ch. 13 - Prob. 3CSCh. 13 - What Are Clones? Cloning is a general term used...Ch. 13 - Prob. 2QPCh. 13 - Prob. 3QP
Ch. 13 - Prob. 4QPCh. 13 - Prob. 5QPCh. 13 - Prob. 6QPCh. 13 - Cloning Genes Is a Multistep Process The following...Ch. 13 - Prob. 8QPCh. 13 - Prob. 9QPCh. 13 - Cloning Genes Is a Multistep Process Which enzyme...Ch. 13 - Cloning Genes Is a Multistep Process In cloning...Ch. 13 - Prob. 12QPCh. 13 - Prob. 13QPCh. 13 - Prob. 14QPCh. 13 - Prob. 15QPCh. 13 - Cloned Libraries You are running a PCR to generate...Ch. 13 - Prob. 17QPCh. 13 - Prob. 18QPCh. 13 - Prob. 19QPCh. 13 - Analyzing Cloned Sequences A base change (A to T)...Ch. 13 - Prob. 21QPCh. 13 - Analyzing Cloned Sequences What kind of...Ch. 13 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?arrow_forwardOrder the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bankarrow_forwardTransgenic bacteria can be used to make an alanine rich (GM) plant. Explain how bacteria can be used to produce large amounts as a cheap source of protein. Your explanation will include the role of: Restriction enzymes, plasmids, recombinant DNA, and bacteria.arrow_forward
- 1. What are restriction enzymes.2. Give 5 restriction enzymes and its source.3. What is a restriction map.4. Explain each step used in restriction mapping.STEP 1: Preparation of DNA for restriction analysis.STEP 2: Restriction digestion of DNA.STEP 3: Separation of restricted DNA.STEP 4: Collecting data.STEP 5: Construction of restriction maparrow_forwardPart A. If student counts 63 colonies on their 10^-6 dilution LB plate. What was the original concentration of their cells if they plated 100ul? Part B.If we used pGFPuv as the template for PCR positive control. This is because: a. it contains the GFP gene so it should show a product. b. It contains DNA fragments that were added to the ligation reaction. c. It is the desired plasmid we wanted to make. d. So we have a band to compare our unknown plasid to allowing us to check if the unknown is the right size.arrow_forwardRestriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA?arrow_forward
- Choose the one answer that fits best. Which statement regarding Molecular Biology is NOT correct (videos)? a. Taq Polymerase was isolated from an organism found in Yellowstone Park b. Restriction enzymes leave sticky ends c. DNA sequencing allows us to read DNA sequences d. Restriction enzymes cut DNA at specific sites e. EcoRI and HindII are commonly used polymerasesarrow_forwardA marine biologist and cancer researcher worked together to isolate the green fluorescent protein (GFP) gene from a sample of jellyfish DNA. Scientists have successfully inserted this gene into a cancerous tumor in humans in order for the tumor to glow so it can be more easily removed during surgery. Once extracted from the jellyfish, how can scientists produce multiple copies of the GFP gene for medical applications? 1. Gel electrophoresis 2. Polymerase chain reaction 3. Restriction enzyme digestion 4. Transgenic technologyarrow_forward1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences (b) Involves joining a donor DNA fragment of interest to a vector Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequencesarrow_forward
- In biotechnology, gene cloning is a very important technique. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is the plasmid. State the three (3) important regions of the plasmid. Elaborate your answer.arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forwarda. If you forgot to add dNTPs to a sequencing reaction, what would be the result? Only very long fragments would be synthesized Only very short fragments would be synthesized The fragments would not be labelled DNA polymerase would be inactivated Sequencing would proceed normally b. Please also answer the imagearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License