CAMPBELL MASTERING BIOLOGY ACCESS>I<
18th Edition
ISBN: 9781323766286
Author: Pearson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14, Problem 11TYU
Summary Introduction
To explain:
The evolutionary pattern regarding the coding of most amino acids by a set of similar codons.
Introduction:
The unit of genetic code, which has three
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
DNA is comprised of 4 bases (ACTG) to code for all 20 amino acids represented in an amino acid table. What if there were there 300 unique amino acids, would be the minimum number of bases required in each codon? Explain how you reached that conclusion.
Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How
would the researchers determine which codon encoded each of these amino acids?
5’CGUCGUCGUCGUCGUCGUCGUCGU...3’
You discover life on an alien planet. The organism is similar to life on Earth except its DNA is comprised only of A and T (there are no C or G in its genome). If the organism follows the same central dogma as life on Earth, reads triplet codons like life on Earth, and has at least one stop codon, what is the maximum number of different amino acids that could be found in the organisms’ proteins?
Chapter 14 Solutions
CAMPBELL MASTERING BIOLOGY ACCESS>I<
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Fill in the following table: Type of RNA Functions...Ch. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracyarrow_forwardTitin is a muscle protein named for its size. Its gene has the largest known coding sequence of 80,781 DNA bases. How many amino acids long is it?arrow_forwardPlease explain why it is useful that our RNA is read in codons. Imagine a hypothetical scenario where there are 95 amino acids and only 6 nucleotides available. Calculate how many nucleotides per codon would be required to code for all 95 amino acids. Show and explain your work.arrow_forward
- ANSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the second codon to an A. Ø What effect does this mutation have on the polypeptide? Compare to the original polypeptide. arrow_forwardUse this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A nonsense mutationarrow_forwardUse this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutationarrow_forward
- The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.arrow_forward1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is locatedarrow_forwardUse this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) 1) A silent mutation that is also a transitionarrow_forward
- Referring to the genetic code, what is meant by "wobble"? Relaxed pairing specificities in the third-base position of a codon Relaxed pairing specificities in the first-base position of a codon Relaxed pairing specificities in the second-base position of a codon Three sequences that do not code for amino acidsarrow_forwardWhat is the Central Dogma of biology?•. Name FOUR polymers in your body rightnOW.‡. DRAW the new DNA codon for your NEWamino acid (5'-3")gDRAW the new mRNA codon for yournew amino acid (5'-3°).arrow_forwardFrom the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax