Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 19, Problem 27CONQ
Summary Introduction
To review:
The effects on replication of the given DNA (deoxyribonucleic acid) sequence after the following treatments:
Treatment with nitrous acid.
Treatment with nitrous acid, followed by its removal, and then continued replication of DNA.
Introduction:
Nitrous acid is a common chemical agent that can act as a mutagen and causes deamination of bases. This can lead to a cytosine (C) getting converted into uracil (U), or adenine (A) getting converted into hypoxanthine (H), which can cause mutations in the DNA sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the sequence of a strand of DNA replicated using each of the following base sequences as a template: a. T C G A G A A T C T C G A T T b. C C G T A T A G C C G G T A C c. A T C G G A T C G C T A C T G
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary?
5'-TGACTAACTG-3'
3'-TGACTAACTG-5'
3'-CAGTTAGTCA-5'
3'-TGACTAACTG-5'
Refer to Figure 2 and compare this with the DNA model in Figure 1.
a. In what ways are they similar?
b. In what ways are they different?
c. What is the biological significance of such differences? Why is the DNA referred to as the genetic material?
Chapter 19 Solutions
Genetics: Analysis and Principles
Ch. 19.1 - 1. A mutation changes a codon that specifies...Ch. 19.1 - A down promoter mutation causes the promoter of a...Ch. 19.1 - 3. A mutation in one gene that reverses the...Ch. 19.1 - Which of the following is an example of a somatic...Ch. 19.2 - Prob. 1COMQCh. 19.3 - Which of the following is not an example of a...Ch. 19.3 - A point mutation could be caused by a....Ch. 19.3 - One way that TNRE may occur involves the formation...Ch. 19.4 - Nitrous acid replaces amino groups with keto...Ch. 19.4 - Prob. 2COMQ
Ch. 19.4 - Prob. 3COMQCh. 19.5 - The function of photolyase is to repair a....Ch. 19.5 - Which of the following DNA repair systems may...Ch. 19.5 - 3. In nucleotide excision repair in E. coli, the...Ch. 19.5 - Prob. 4COMQCh. 19.5 - An advantage of translesion-replicating...Ch. 19 - Is each of the following mutations a transition,...Ch. 19 - Prob. 2CONQCh. 19 - What does a suppressor mutation suppress? What is...Ch. 19 - Prob. 4CONQCh. 19 - X-rays strike a chromosome in a living cell and...Ch. 19 - Prob. 6CONQCh. 19 - Prob. 7CONQCh. 19 - 8. A point mutation occurs in the middle of the...Ch. 19 - Prob. 9CONQCh. 19 - Prob. 10CONQCh. 19 - 11. Is a random mutation more likely to be...Ch. 19 - 12. Which of the following mutations could be...Ch. 19 - Prob. 13CONQCh. 19 - Discuss the consequences of a germ-line versus a...Ch. 19 - Prob. 15CONQCh. 19 - Explain how a mutagen can interfere with DNA...Ch. 19 - What type of mutation (transition, transversion,...Ch. 19 - Explain what happens to the sequence of DNA during...Ch. 19 - Distinguish between spontaneous and induced...Ch. 19 - Prob. 20CONQCh. 19 - Prob. 21CONQCh. 19 - Prob. 22CONQCh. 19 - Trinucleotide repeat expansions (TNREs) are...Ch. 19 - 24. With regard to TNRE, what is meant by the term...Ch. 19 - 25. What is the difference between the mutation...Ch. 19 - Achondroplasia is a rare form of dwarfism. It is...Ch. 19 - Prob. 27CONQCh. 19 - In the treatment of cancer, the basis for many...Ch. 19 - Prob. 29CONQCh. 19 - 30. Which of the following examples is likely to...Ch. 19 - Prob. 31CONQCh. 19 - Prob. 32CONQCh. 19 - Prob. 33CONQCh. 19 - With regard to the repair of double-strand breaks,...Ch. 19 - Prob. 35CONQCh. 19 - Prob. 36CONQCh. 19 - 37. Three common ways to repair changes in DNA...Ch. 19 - Prob. 38CONQCh. 19 - Prob. 39CONQCh. 19 - Explain how the technique of replica plating...Ch. 19 - 2. Outline how you would use the technique of...Ch. 19 - 3. From an experimental point of view, is it...Ch. 19 - Prob. 4EQCh. 19 - Prob. 5EQCh. 19 - 6. Richard Boyce and Paul Howard-Flanders...Ch. 19 - In E. coli, a variety of mutator strains have been...Ch. 19 - 2. Discuss the times in a person’s life when it is...Ch. 19 - A large amount of research is aimed at studying...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine, guanine, and thymine). (a) How many DNA sequences are exactly 24 letters long? (b) Given a DNA sequence of length 24, how many single letter mutations are possible? (c) Given a DNA sequence of length 24, how many double letter mutations are possible?arrow_forwardA DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAGarrow_forwardWhen performing Sanger sequencing a scientist accidentally forgot to include ddGTP in his sequencing reaction (he did include ddATP, ddCTP, and ddTTP along with all the other needed components). Which of the following statements are true? A.All DNA fragments will terminate at the first G base pair B.A color will be missing from the chromatogram. C.The sequencing primer will not contain G base pairs. D.There will be gaps in the chromatogram.arrow_forward
- the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?arrow_forwardIn pcr experiment, Does electrophoresis show that only DNA products of the desired size are present? If not, what do you think is the reason?arrow_forwardWhich of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.arrow_forward
- A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.arrow_forwardAssuming DNA replicates semi-conservatively, which of these most closely approximates what you would see after one generation if you were to perform the Meselson-Stahl experiment? one band two bands three bandsarrow_forwardIf we are given this segment of DNA: TTGGHTGUTGG HHUUTHUGHUU Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated two times? (note Hypoxanthine pairs with cytosine) and so there would be four sets?arrow_forward
- A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTG ACG TAA A mutation in the above sequence involved a substitution of a single base, but did not affect the protein produced when the gene involved was transcribed and translated. Which of the following gene sequences could have the mutation described above? a. GTT GTG ACA TAA b. GTT GGG ACG TAA c. GTA GTG ACG TAA d. GTT GTG ACT TAAarrow_forwardDuring DNA isolation, you incubated the tissue sample at 55°C for 60 minutes, followed by incubation at 95°C for 10 minutes. What happens to the DNA molecules in this last 95°C incubation? What would happen to the PCR if this step was omitted?arrow_forwardPlease answer the following question and explain Q1. If MacLeod and McCarty had accidentally contaminated their RNase enzyme with DNase, how would this have changed the conclusion that they made from their experiments? Pick the correct letter option A. They would have concluded that DNA is the only molecule required for genetic transformation. B. They would have concluded that DNA and protein are both required for genetic transformation. C. They would have concluded that RNA is the only molecule required for genetic transformation. D. They would have concluded that RNA and DNA are both required for genetic transformation. E. They would have concluded that proteins are the only molecules required for genetic transformationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License