Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 20.3CC
Compare the basic “state” of a gene in bacteria versus eukaryotes with respect to activation of transcription. How are they similar? How are they different?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Briefly describe three stages of transcription. How is transcription initiated? How is transcription terminated?
Discuss and make a list of the similarities and differences in theevents that occur during the initiation, elongation, and terminationstages of transcription and translation.
Suppose that the string of A nucleotide following the inverted repeat in a rho-independent terminator were deleted, but the the inverted was left intact. How will this deletion affect transcription termination?
Chapter 20 Solutions
Becker's World of the Cell (9th Edition)
Ch. 20 - Suppose you are analyzing a haploid E. coli strain...Ch. 20 - How do epigenetic changes, such as DNA...Ch. 20 - Compare the basic state of a gene in bacteria...Ch. 20 - Prob. 1QCh. 20 - Prob. 20.4CCCh. 20 - Prob. 20.1PSCh. 20 - The Pickled Prokaryote. Pickelensia hypothetica is...Ch. 20 - Prob. 20.3PSCh. 20 - Attenuation in 25 or Fewer Words. Complete each of...Ch. 20 - Prob. 20.5PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are two differences between promoters and enhancers? (Hint: where are they located relative to the transcription start site?)arrow_forwardWhat is meant by the term chromatin remodeling? Describe the importance of this process to transcription.arrow_forwardWhy it is that transcription & translation could be coupled in prokaryotic cell but not in eukaryotic cell?arrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?arrow_forwardOutline the three stages of transcription and the role of RNA polymerase in this process. How accurate is transcription? How does transcription differ in prokaryotes and eukaryotes?arrow_forwardSeveral examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?arrow_forward
- Many promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?arrow_forwardName four major classes of DNA-binding proteins that are responsible for controlling transcription, and describe their structural features.arrow_forwardPlease explain: Transcription-what is it and what does it involve? What happens at initiation, elongation, and termination?arrow_forward
- What is "wobble" controlled during transcription in a prokaryotic cell? Explain briefly.arrow_forwardMany eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?arrow_forwardOutline the essential features of the three basic phases of transcription. How might each of them be targeted to regulate gene expression? Which of the three phases is the most common target of regulatory mechanisms?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license