Concept explainers
(a)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it is located 1000
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(b)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it is in the gene’s coding region.” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(c)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when no promoter is present” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(d)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it causes looping out of the intervening DNA.” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
(e)
To determine: Whether the statement, “An enhancer may increase the frequency of transcription initiation for its associated gene when it causes alternative splicing of the DNA.” is true or false.
Introduction: A short part of the DNA which is involved in increasing the probability of transcription of a particular gene is called an enhancer. It is usually 50-1500 base pairs long. Usually, proteins such as activators bind it to the DNA.
Want to see the full answer?
Check out a sample textbook solutionChapter 20 Solutions
Becker's World of the Cell (9th Edition)
- Question:- Which statement below about gene expression is TRUE? A. Transcription initiation begins when RNA polymerase bind to the transcription start site. B. RNA processing removes exons, adds a 3' cap, and adds and 5' tail. C. Translation terninates when a tRNA carrying methionine binds to a codon. D. The same amino acid may be encoded by multiple different 3-base codons.arrow_forwardTranscriptional regulation You are interested in studying the transcriptional regulation of Glp1 promoter. This gene contains a binding site for two proteins A and B. Proteins A and B cannot bind to the DNA at the same time due to steric interference caused by a slight overlap in their binding sites. The binding sites of protein A and protein B can be seen in the figure below. Protein A binds to Site C and Protein B binds to site D. To assess whether either A or B have an influence on Glp1 expression, you create mutations in the DNA that selectively remove the non-overlapping sequences of binding site C or binding site D. You then examine Glp1 mRNA production within adult liver cells. You receive the following data. Experiment number Binding site C Binding site D Glp1 mRNA levels 1 + + high 2 + - high 3 - + none 4 - - none += binding site present, -= binding site absent What does this data tell us about which protein is…arrow_forwardBinding of --------- identifies the decoding center of the ribosome.arrow_forward
- True/false? if false, justify brieflyBacterial operons gather open-reading-frames that are coupled for both transcription and translation.arrow_forwardTranscription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2arrow_forwardProtein expression: Given that we control the composition of the medium in which we grow our bacteria, are there any additional advantages of recombinant expression of proteins compared to using chemical synthesis?arrow_forward
- Question:- Fill the Blank! In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during translation initiation, while in eukaryotes, the _______ consensus sequence of mRNA contains the_____.arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:arrow_forwardmRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.arrow_forward
- True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.arrow_forwardQuestion:- Define the transcription unit. How does it differ from the gene? Describe how you would determine the 5' and 3' ends of a transcription unit in a genome browser.arrow_forwardYes or no? reverse genetics is RNA interference example. cellular differentiation potency in multipotent is greater than pluripotent stem cell. does digoxigenin UTO use to make dsrna and perform rna interference?arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax