Concept explainers
a)
Interpretation:
The mRNA strand from the given DNA template strand has to be predicted.
Concept Introduction:
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
Illustrated relationships are:
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
b)
Interpretation:
The mRNA strand from the given DNA template strand has to be predicted.
Concept Introduction:
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
Illustrated relationships are:
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
Fundamentals of General, Organic, and Biological Chemistry (8th Edition)
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardIf the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forward
- An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bparrow_forwardThe following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-arrow_forwardIf the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forward
- A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardWhat will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'arrow_forward
- The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?arrow_forwardFor each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid sequences that have been left blank. DNA______ ______ ______ ______ ______ ______ ______ ______ ______ mRNA A U G A C U A G C U G G G G G U A U U A C U U U U A G AA______ ______ ______ ______ ______ ______ ______ ______ ______arrow_forwardTemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning