Concept explainers
(a)
Interpretation:
For the given DNA template strand, 5’-ATCTACCGTTA-3’, the sequence for the mRNA molecule needs to be determined.
Concept introduction:
mRNA sequence is the coding of genes as well as an amino acid. In transcription and replication, this sequence is used.
(b)
Interpretation:
For the given mRNA base sequence 5’-UUGCCUAGUGAUUGGAUG-3’ by assuming reading fame starts from 5’ end. The amino acid sequence that can be formed needs to be determined.
Concept introduction:
mRNA sequence can be determined based on Condon chart.
(c)
Interpretation:
The sequence of the polypeptide formed due to the addition of poly (UUAC) to a cell-free protein-synthesizing system needs to be determined.
Concept introduction:
The sequence of the protein can be given by DNA which encodes a protein and also change in DNA sequence will change the amino acid sequence of proteins.
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
- Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forwardA mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.arrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forward
- First Position (5'-end) U C A U UUU Phe UUC Phe UUA Leu UUG Leu G CUU Leu CUC Leu CUA Leu CUG Leu AUU Ile AUC Ile AUA Ile AUG* Met GUU Val GUC Val GUA Val GUG Val с UCU UCC UCA UCG Ser Second Position A CCU Pro CCC Pro CCA Pro CCG Pro ACU ACC Ser Ser Ser Thr Thr ACA Thr ACG Thr GCU GCC Ala Ala GCA Ala GCG Ala *AUG also serves as the principal initiation codon. G UAU Tyr UGU UAC Tyr UGC UAA Stop UGA UAG Stop UGG CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA AAG GAU Asp GAC Asp GAA Glu GAG Glu CGU Arg CGC Arg CGA Arg CGG Arg Lys AGA Lys AGG Cys Cys Stop Trp AGU Ser AGC Ser GGU GGC Arg Arg Gly Gly GGA Gly GGG Gly Third Position (3'-end) DOAG DOAG U C U C DOAG DOAG U C U Carrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardA. If a nascent MRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of nucleotide bases) was removed during mRNA processing, how many amino acids is expected to be in the protein that the matured mRNA codes for? [ Select ] Note: Include the start and stop codons in your analysis. B. If the first five codons of the MRNA is AUGAUGAUGAUGAUG, what is the amino acid sequence of the pentapeptide that the five codons will make? [ Select ]arrow_forward
- A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)arrow_forward(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…arrow_forwardFor each of the five short mRNA nucleotide sequences given in the table below: 3. Translate the original sequence (for these short sequences start translation at the first nucleotide) 4. Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences 5. For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above) 6. Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If so, what is the effect of the mutation on protein structure (amino acid sequence; see #2 above)arrow_forward
- A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.arrow_forward1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.arrow_forwardB. A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA bases required to code for the amino acids in this polypeptide. Show your calculation. (ii) Does AUG appear in the first three nucleotides in the mRNA coding for this mRNA? Explain why.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning